b predicted mechanism of bu cytotoxicity in folliculogenesis via suppression of c kit scf signaling

Mechanism of hydrogen sulphide mediated signaling cascade through n methyl d aspartate receptors

Mechanism of hydrogen sulphide mediated signaling cascade through n methyl d aspartate receptors

Ngày tải lên : 10/11/2015, 12:35
... present in abundance in the brain particularly the hippocampus and Purkinjes cells (Robert et al., 2003) Activity of brain CBS, like that of NO synthase, is both calcium- and calmodulindependent ... the junction of NR1 and NR2 subunits Full activation of the NMDA receptors is achieved by the binding of glutamate and, glycine, a co-agonist binding on a site on NR1 subunit The binding site ... % CO2 and 95 % air incubator at 37 C Immunocytochemical staining of the cultures at day in vitro for microtubule-associated protein and glia fibrillary acidic protein revealed > 95 % of the cells...
  • 167
  • 290
  • 0
báo cáo khoa học: "Gastrointestinal Stromal Tumours treated before and after the advent of c-kit immunostaining" pptx

báo cáo khoa học: "Gastrointestinal Stromal Tumours treated before and after the advent of c-kit immunostaining" pptx

Ngày tải lên : 09/08/2014, 01:24
... G, Bertolini F, Valli R, Cirilli C, Rashid I, Marcheselli L, Luppi G, Federico M: Incidence and clinicopathologic features of gastrointestinal stromal tumors A population-based study BMC Cancer ... Gastrointestinal stromal tumors in Iceland, 1990-2003: the icelandic GIST study, a population-based incidence and pathologic risk stratification study Int J Cancer 2005, 117(2):289-93 Mucciarini C, ... placebo-controlled trial, that imatinib improves recurrence-free survival following complete resection of GISTs Some clear recommendations of management of such retrospectively identified cases...
  • 4
  • 320
  • 0
Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt

Ngày tải lên : 08/03/2014, 23:20
... PCR fragment containing the mutation N373D was constructed in a two-step protocol For the PCR fragment encoding the N-terminal part of the b subunit, primers Kpn2Ifor (5¢-GCTTCGGCGGCCTGCTCTCC-3¢) ... translocating enzymes Biochim Biophys Acta 1318, 11–51 Dimroth, P & Schink, B (1998) Energy conservation in the decarboxylation of dicarboxylic acids by fermenting bacteria Arch Microbiol 170, ... (5¢-AGCCGATCAGCGGATCGATTTTGTG CCGG-3¢) were used For the PCR fragment encoding the corresponding C- terminal part, primers Bstrev10800 (5¢-GGCAAACCAGTGGGTGATTTTTCG-3¢) and N373Dfor (5¢-CCGGCACAAAATCGATCCGCTGATC...
  • 8
  • 508
  • 0
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Ngày tải lên : 30/03/2014, 11:20
... differences in FFA concentrations between epinephrine and saline incubations (A) (B) Effect of 15 preincubation of human adipocytes with either B[ a]P (j) or saline (h) followed by 45 incubation ... follows epinephrine injections Maximal B[ a]P inhibition corresponding to 70% inhibition of the epinephrine lipolytic effect was achieved with a B[ a]P concentration of 0.4 mgÆkg)1 Injection of B[ a]P ... samples were rinsed with Kreb’s Ringer bicarbonate buffer (KRBB) supplemented with 4% (w ⁄ v) bovine serum albumin (BSA) and mm glucose and then incubated 45 at 37 C in the presence of collagenase...
  • 11
  • 424
  • 0
Báo cáo y học: "Potential role and mechanism of IFN-gamma inducible protein-10 on receptor activator of nuclear factor kappa-B ligand (RANKL) expression in rheumatoid arthritis" pptx

Báo cáo y học: "Potential role and mechanism of IFN-gamma inducible protein-10 on receptor activator of nuclear factor kappa-B ligand (RANKL) expression in rheumatoid arthritis" pptx

Ngày tải lên : 12/08/2014, 17:22
... TTAAGCCAGTGCTTCACGGG; reverse: ACGTAGACCACGATGATGTCGC) Levels of OPG in cultured RA synoviocytes were measured by using a commercial ELISA kit (R&D Systems, Inc.) Page of Results CXCL10 concentrations ... TGACTCTAAGTGGCATTCAAGG; reverse: GATTCAGACATCTCTTCTCACCC) and by Western blotting using anti-CXCL10 antibody (R&D Systems, Inc.) RANKL expressions in synoviocytes, Jurkat T cells, Hut 78 T cells, ... lysed in a lysis buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) by incubating the suspension on ice for 20 minutes The protein concentration of the lysate was measured using the bicinchoninic...
  • 8
  • 176
  • 0
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"

Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"

Ngày tải lên : 25/10/2012, 11:48
... Histological features of HBeAg-negative CHB patients with or without steatosis were summarized in Table Table Clinical characteristics and anthropometric indices of HBeAg-negative CHB patients ... non-alcoholic fatty liver disease (NAFLD) has been increasing in the past decades (4,10) Increasing studies on chronic hepatitis C with hepatic steatosis have been conducted, but little is known about ... Impact of non-alcoholic fatty liver disease on chronic hepatitis B Liver Int 2007;27:607-11 Browning JD, Szczepaniak LS, Dobbins R, et al Prevalence of hepatic steatosis in an urban population in...
  • 6
  • 606
  • 0
Báo cáo y học: "Ultra-low microcurrent in the management of diabetes mellitus, hypertension and chronic wounds: Report of twelve cases and discussion of mechanism of action"

Báo cáo y học: "Ultra-low microcurrent in the management of diabetes mellitus, hypertension and chronic wounds: Report of twelve cases and discussion of mechanism of action"

Ngày tải lên : 26/10/2012, 09:39
... Source of reactive oxygen species in insulin secreting pancreatic β-cells and cells that are targets for insulin action is considered to be the mitochondrial electron transport chain Hyperglycemia ... dysfunction contributes to pathological conditions such as vascular complications of diabetes, neurodegenerative diseases and http://www.medsci.org Int J Med Sci 2010, cellular senescence (40-45) ... correct malalignments in the cells electrical system but it also eliminates free radicals and then stimulates the mitochondria to produce ATP Microcurrent has been successfully used to enhance...
  • 7
  • 813
  • 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Ngày tải lên : 18/02/2014, 04:20
... mobility of cytosolic cytochrome c ( 15 kDa) (C) Hepatic cytosolic fractions isolated from ETA-injected or DT-injected rats were incubated with fluorescent substrates speci c for caspase-9, caspase-3, ... Structural characteristics of ETA fragments generated by cathepsin B and cathepsin D (A) Native ETA (10 lg) was incubated with bovine cathepsin B or cathepsin D (5 UÆmL)1Æmg)1), or a mixture of both, ... h By contrast, administration of diphtheria toxin (DT) (a toxin that does not access the cytoplasm of rodent cells [24]) did not cause a detectable change in the level of cytochrome c in the cytoplasmic...
  • 15
  • 588
  • 0
Tài liệu Báo cáo khoa học: On the mechanism of action of the antifungal agent propionate Propionyl-CoA inhibits glucose metabolism in Aspergillus nidulans doc

Tài liệu Báo cáo khoa học: On the mechanism of action of the antifungal agent propionate Propionyl-CoA inhibits glucose metabolism in Aspergillus nidulans doc

Ngày tải lên : 19/02/2014, 16:20
... Fab4-J3 DmcsA Acs Acs Acs Acs Acs Acs Acs Pcs Pcs Pcs Pcs Pcs Pcs Pcs Icl Icl Icl Icl Icl Icl Icl Micl Micl Micl Micl Micl Micl Micl McsA McsA McsA McsA McsA McsA McsA G50 G50/A100 G50/P100 G50/A100/P100 ... partial block of the citric acid cycle at the level of succinyl-CoA synthetase CoA-transferase activity As mentioned above, succinyl-CoA synthetase is almost completely blocked by the combined action ... Ó FEBS 2004 3232 M Brock and W Buckel (Eur J Biochem 271) Table Carbon balances of wild-type and DmcsA strain Balances are calculated for g of dried mycelium The concentrations of the substrates...
  • 15
  • 678
  • 0
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

Ngày tải lên : 19/02/2014, 16:20
... bearing nonbranched substituents without functional groups, the hydrophobicity of the side chain is the main factor controlling Ki Amino acids that contain nucleophilic side chains (L-aspartic acid, ... Escherichia coli SVS370 cells containing plasmid pTZTPL, which contains the tpl gene from Citrobacter freundii in pTZ18U (US Biochemical, Cleveland, OH, USA), as described [10] The enzyme obtained ... respect to the cofactor plane [17], and shows that the pattern of binding is the same for a variety of amino acids It has been established [5] that for a number of amino acid inhibitors bearing...
  • 7
  • 532
  • 0
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

Ngày tải lên : 20/02/2014, 11:20
... 125I-labelled MSSAE was incubated in binding buffer in the absence of cells no dimerization occurred (data not shown) These results indicate that a monomeric derivative of BSRNase in which disulde bonds ... Penicillin-Streptomycin-Glutamine 1X (Gibco-Life Technology) Cell lines were maintained at 37 C in a humidied incubator containing 10% CO2 mixed with air Cytotoxicity assay Cells were seeded in 24- or ... bis-Cys31,Cys32-S-carboxymethylated-BS-RNase), MCA (monomeric bis-Cys31,Cys32-S-carboxyamidomethylatedBS-RNase), and MAE (monomeric bis-Cys31,Cys32-Saminoethylated-BS-RNase) were obtained by selective reduction of the protein intersubunit...
  • 8
  • 604
  • 0
Báo cáo khoa học: Conservation of the egg envelope digestion mechanism of hatching enzyme in euteleostean fishes pot

Báo cáo khoa học: Conservation of the egg envelope digestion mechanism of hatching enzyme in euteleostean fishes pot

Ngày tải lên : 06/03/2014, 02:20
... 5¢-AATCCTGCTACTTTG GAACAGGAGCAACCG-3¢; OlChgH-R: 5¢-GTCCCACT GGGGCAGGCTGAAAGCATTGGG-3¢; 5¢-RACE: 5¢-AA GTGAATTGGAGTCAACATGTGTACAGCC-3¢; and 3¢-RACE: 5¢-TAGCCTACACCTCCTACTATTTGGACT CAG-3¢ 4984 For cloning ... FhChgL cDNA were: 5¢-RACE (for first PCR): 5¢-CCAAAGTTATTAATGAAGGCATAACTGGGG-3¢; 5¢-RACE (for nested PCR): 5¢-TAAACACGCAGGGGCACGTGGAAGTACT GC-3¢; 3¢-RACE (for first PCR): 5¢-CCACTACCCAAGGA GGCACAATGTGAGCAG-3¢; ... first PCR): 5¢-GGCAAAAGCT GAAGTTGTACCAACAGGACC-3¢; 5¢-RACE (for nested PCR): 5¢-TTTGGACCACCTCCTAGCAAACTTATTGAC-3¢; 3¢-RACE (for first PCR): 5¢-ATGTCAAGCTATAAACTG TTGCTATGATGG-3¢; and 3¢-RACE (for...
  • 15
  • 353
  • 0
Báo cáo khoa học: Spectroscopic investigation of the reaction mechanism of CopB-B, the catalytic fragment from an archaeal thermophilic ATP-driven heavy metal transporter potx

Báo cáo khoa học: Spectroscopic investigation of the reaction mechanism of CopB-B, the catalytic fragment from an archaeal thermophilic ATP-driven heavy metal transporter potx

Ngày tải lên : 07/03/2014, 00:20
... experiments Protein content was determined by the bicinchoninic acid method [36] Hydrolytic mechanism of the catalytic CPx-ATPase domain Fluorescence spectroscopy and equilibrium binding of nucleotides ... Results Nucleotide binding to CopB -B The catalytic fragment N P, also called CopB -B, consists of the nucleotide binding and phosphorylation Hydrolytic mechanism of the catalytic CPx-ATPase domain Fig ... Journal compilation ê 2009 FEBS 6175 Hydrolytic mechanism of the catalytic CPx-ATPase domain A B Fig Catalytic properties of CopB -B (A) Substrate kinetics of 10 lM CopB -B with Mg-ATP at 70 C (B) Temperature...
  • 15
  • 441
  • 0
Báo cáo khoa học: Transthyretin and familial amyloidotic polyneuropathy Recent progress in understanding the molecular mechanism of neurodegeneration pdf

Báo cáo khoa học: Transthyretin and familial amyloidotic polyneuropathy Recent progress in understanding the molecular mechanism of neurodegeneration pdf

Ngày tải lên : 07/03/2014, 10:20
... Journal compilation ª 2007 FEBS 1639 Role of transthyretin in FAP X Hou et al A C N C N Chain A Chain B B H G A D F E B C Fig Structure of a human TTR dimer (protein data bank accession code 1THC) ... structure of TTR has been maintained over vertebrate evolution, and, notably, the amino-acid sequences in the thyroxine-binding site are identical in all species examined to date [82] Mechanism of ... calcium in ux via voltage-gated calcium channels High-molecular-mass (fibrillar) species were found to be much less effective in their ability to induce calcium in ux The identification of toxic species...
  • 14
  • 488
  • 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Ngày tải lên : 07/03/2014, 16:20
... shuttling of endocytic proteins J Biol Chem 153, 1511–1517 11 Peng, G & Hopper, J.E (2002) Gene activation by interaction of an inhibitor with a cytoplasmic signaling protein Proc Natl Acad Sci ... from studies in molecular biology and bioinformatics can limit the number of candidate models Finally, the relevance of the different mechanisms at the system level can be obtained by such a steady-state ... wild-type is the shuttling of Gal80p Increasing the amount of Gal80p in the cytoplasm by increasing the distribution coefficient (K) causes the switch to turn on at very low galactose concentrations On...
  • 11
  • 490
  • 0
Báo cáo Y học: The mechanism of nitrogen monoxide (NO)-mediated iron mobilization from cells NO intercepts iron before incorporation into ferritin and indirectly mobilizes iron from ferritin in a glutathione-dependent manner pot

Báo cáo Y học: The mechanism of nitrogen monoxide (NO)-mediated iron mobilization from cells NO intercepts iron before incorporation into ferritin and indirectly mobilizes iron from ferritin in a glutathione-dependent manner pot

Ngày tải lên : 08/03/2014, 22:20
... performed Examining the intracellular distribution of 59Fe in control cells, ferritin-59Fe increased as a function of reincubation time (Fig 3B) In fact, after a reincubation time of 240 in control ... transport of iron in normal and neoplastic cells Biochim Biophys Acta 1331, 1–40 Drapier, J. -C & Hibbs, J .B Jr (1986) Murine cytotoxic activated macrophages inhibit aconitase in tumor cells Inhibition ... incorporation into ferritin gradually increasing as a function of reincubation time (Fig 3B) In contrast, in cells treated with GSNO, ferritin-59Fe levels decreased after 90 of reincubation In fact, after...
  • 10
  • 503
  • 0
Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx

Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx

Ngày tải lên : 14/03/2014, 23:20
... (5¢-CG TGCACCACAGCCTGCTGACGATGAAGAG-3¢); AKR1 B1 H110F (F) (5¢-CCTCTACCTTATTTTCTGGCCGACT GGC-3¢) and (R) (5¢-GCCAGTCGGCCAGAAAATAAG GTAGAGG-3¢); AKR 1B1 H110A (F) (5¢-CCTCTACCTT ATTGCCTGGCCGACTGGC-3¢) ... (5¢-CATTCTCATTCTGGAACACATGGGCACAG-3¢); AKR 1B1 K77L (F) (5¢-CTTCATCGTCAGCCTGCTGTG GTGCACG-3¢) and (R) (5¢-CGTGCACCACAGCAGGCT GACGATGAAG-3¢); AKR 1B1 K77R (F) (5¢-CTCTTCA TCGTCAGCAGGCTGTGGTGCACG-3¢) ... (R) (5¢-CACATGGGCACAGTTGATGTGGCGG TACC-3¢); AKR 1B1 D43E (F) (5¢-GGGTACCGCCACA TCGAATGTGCCCATGTG-3¢) and (R) (5¢-CACATGGG CACATTCGATGTGGCGGTACCC-3¢); AKR 1B1 Y48F (F) (5¢-CTGTGCCCATGTGTTCCAGAATGAGAATG-3¢)...
  • 11
  • 390
  • 0
Báo cáo khoa học: The role of Tyr71 in Streptomyces trypsin on the recognition mechanism of structural protein substrates ppt

Báo cáo khoa học: The role of Tyr71 in Streptomyces trypsin on the recognition mechanism of structural protein substrates ppt

Ngày tải lên : 16/03/2014, 00:20
... primers incorporating the NdeI site of sot (5¢-CATATGCAGAAGAACCGACTCGTCC-3¢) and the HindIII site of sprT (5¢-TGCCGGTACGAAGCTTCA GAGCGTGCG-3¢) Recombination sites were determined in detail using ... A A A A Specific activity (U·mg–1) Specific activity (U·mg–1) B Y Uesugi et al B- 1 B- 2 B- 3 B- 4 B C B- 1 B- 2 B- 3 B- 4 E Type IV/I 0.3 D82 0.2 S172 0.1 H37 B B-1 B- 2 B- 3 B- 4 Y71 C specificity among ... [5¢-GATCTA CCG(A fi G)GCCCCCGGCTACAACGGCA-3¢ for silent mutation of the ApaI site (in italic type), corresponding to nucleotides 324–352 from sot] and a reverse primer (5¢-AAGCTTTACAGCGTGGCCGCGGCGG-3¢,...
  • 13
  • 469
  • 0
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx

Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx

Ngày tải lên : 16/03/2014, 06:20
... CTTTCCACAGACGCACCAAATTCATC CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG CGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG CCTATTATCTTGCGATTGTTCCGAAAGC GCTTTCGGAACAATCGCAAGATAATAGG GCAGCATTATCGATCTACGGAGAAGATGC GCATCTTCTCCGTAGATCGATAATGCTGC ... GCTGGACATCGCCAAACATTTTTATTCACCCG CGGGTGAATAAAAATGTTTGGCGATGTCCAGC GGTGGCAACGAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTCGTTGCCACC GGTGGCGATCAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTGATCGCCACC GATGAATTTGGTGCGTCTGTGGAAAG CTTTCCACAGACGCACCAAATTCATC ... jack bean enzyme Inhibition of DspB by NAG-thiazoline is consistent with an anchimeric assistance mechanism occurring during catalysis in DspB because NAGthiazoline is a mechanism- based inhibitor...
  • 13
  • 311
  • 0
A study in the growth mechanism of silicon nanowires with or without metal catalyst

A study in the growth mechanism of silicon nanowires with or without metal catalyst

Ngày tải lên : 16/03/2014, 15:09
... sputtering, or electrochemical methods The particle size can be modified by varying the reaction parameters In particular, the catalyst distribution can be well-organized by using a nano-channel-alumina ... combine to form a bigger one, leading to an intercrossing structure Fig 3B clearly shows the original growth stage of SiNWs As can be seen from the figure, if Si atoms cannot be added continuously ... analyzed by scanning electron microscopy (SEM, JSM-5610LV) and transmission electron microscopy (TEM, JEM2100F) Results and discussion 3.1 Metal-assisted growth of SiNWs A basic aspect of the VLS mechanism...
  • 5
  • 576
  • 0