b deflection of light by a gravitational field
Báo cáo hóa học: "Research Article The Problem of Scattering by a Mixture of Cracks and Obstacles" pptx
... infinite cylinder having an open crack Γ and a bounded domain D in R2 as cross section We assume that the cylinder is possibly partially coated on one side by a material with surface impedance λ This ... problem and reformulate the problem as a boundary integral system by using single- and double-layer potentials The existence and uniqueness of a solution to the corresponding boundary integral ... problem can be considered by similar methods in 1, 2, 4–12 and the reference therein Briefly speaking, in this paper we consider the scattering of an electromagnetic timeharmonic plane wave by an...
- 19
- 271
- 0
Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx
... demonstrate that CR2-Fc can bind to HIV virions and can result in an amplification of the complement activation cascade As a consequence of this action, HIV would likely be eliminated by CML and ... was dependent on antibodies and mediated by complement and coined the term complement-mediated antibodydependent enhancement (C-ADE) [9] The mechanism of C-ADE has been investigated by several ... 26:3078-3085 Subbramanian RA, Xu J, Toma E, Morisset R, Cohen EA, Menezes J, Ahmad A: Comparison of human immunodeficiency virus (HIV)-specific infection-enhancing and -inhibiting antibodies in AIDS patients...
- 4
- 287
- 0
Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc
... demonstrate that CR2-Fc can bind to HIV virions and can result in an amplification of the complement activation cascade As a consequence of this action, HIV would likely be eliminated by CML and ... was dependent on antibodies and mediated by complement and coined the term complement-mediated antibodydependent enhancement (C-ADE) [9] The mechanism of C-ADE has been investigated by several ... 26:3078-3085 Subbramanian RA, Xu J, Toma E, Morisset R, Cohen EA, Menezes J, Ahmad A: Comparison of human immunodeficiency virus (HIV)-specific infection-enhancing and -inhibiting antibodies in AIDS patients...
- 4
- 271
- 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc
... Kinetics of appearance of ETA in hepatic plasma membranes and endosomes after toxin administration Rat hepatic plasma membrane (A) and endosomal fractions (B) were isolated at the indicated times after ... the mobilities of intact ETA ( 66 kDa), ETA -A ( 37 kDa), and unknown degradation fragments absence of ATP revealed a small amount of degradation for intact ETA, whereas no degradation was observed ... preparation of hepatic subcellular fractions, the amount of internalized ETA was determined by SDS ⁄ PAGE followed by western blot analyses with antibody directed against ETA -A It was assumed that...
- 15
- 588
- 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx
... study by Mason et al [7] indicated that Ab40 was capable of penetrating into rat synaptic plasma membranes, thus decreasing bilayer thickness In addition, Kayed et al [11] report that, although ... incorporate into the membrane and cause a reduction in the thickness of the bilayer, and this observation was corroborated by Ambroggio et al [12] These investigators found that Ab42 could stably ... interactions between Ab and a model membrane can lead to a more complete understanding of the membrane-aided assembly of Ab and the resulting damage to cell membranes FEBS Journal 276 (2009) 3060–3075...
- 16
- 475
- 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx
... whereas the band of the a- subunit showed little change At h of incubation (lane 3), the band of the b- subunit became very faint Some new bands between bands and became clearer and several bands around ... around bands and also became darker The band strength of the b- subunit decreased by 65% after h of incubation, whereas that of the a- subunit decreased only by 10% BSA was not degraded even after days ... of incubation (lane 3), this pattern became more prominent The band of the b- subunit became very faint Some new bands between bands and became clear, and several bands around bands and became stronger...
- 9
- 388
- 0
Báo cáo khoa học: E2A participates in a fine control of pre-mature B-cell apoptosis mediated by B-cell receptor signaling via transcriptional regulation of survivin, IAP2 and caspase-8 genes pot
... treatment by 24 h, and the caspase-10 mRNA level was increased by h and thereafter decreased dramatically by 24 h Expression of caspase-3 and caspase-9 remained unchanged in the presence of PMA/ionomycin ... collaborate to induce apoptotic cell death of the DT40 cell line, through depletion of ICAD [inhibitor of caspase-activated DNase (CAD)] and inhibitor of apoptosis (IAP2), and activation of caspase ... approximately 70% by 16 h) and caspase-9 (to approximately 70% by 16 h), compared with those in DT40, probably due to a balance of the amounts of each of the three caspases and the inhibitors...
- 11
- 349
- 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ... was changed to GGA by using primers 5¢-CCCAAGC TTATGGATGGAGGAGGAGAAAAC-3¢ and 5¢-ACGT ACCGGTCCACAATCTAGGAAGTTTGCAGC-3¢ After digestion of the PCR fragment by EcoRI and AgeI, the fragment was inserted ... coimmunoprecipitation experiment (Fig 2D) demonstrated that a remarkable stabilization of elongin C was caused by the binding of elongin B and, to a lesser extent, stabilization of pVHL was also found as...
- 9
- 420
- 0
Báo cáo khoa học: Photosynthetic acclimation: Structural reorganisation of light harvesting antenna – role of redox-dependent phosphorylation of major and minor chlorophyll a/b binding proteins pot
... photosystems in state transitions J Kargul and J Barber 16 Johnson MP, Havaux M, Triantaphylides C, Ksas B, Pascal AA, Robert B, Davison PA, Ruban AV & Horton P (2007) Elevated zeaxanthin bound to oligomeric ... however, biochemical attempts to isolate the specific enzymes have been unsuccessful to date Nevertheless, by adopting an alternative approach, a small family of three thylakoid-associated kinases (TAKs) ... the particles is assigned as a wide outer contour (yellow) of 15 A Scale bar represents 50 A Data in (A) and (B) were taken from Kargul et al [60] are too labile to be successfully purified by...
- 13
- 343
- 0
By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx
... so badly about the loss of her baby It had always seemed to Maria a most unattractive child, large-headed, flabby, and mottled, with ever an open mouth of resistance, and a loud wail of opposition ... dress had knots of black velvet about it which accentuated it, even as Miss Slome’s face was accentuated by the clear darkness of her eyes and the black puff of her hair above her finely arched brows ... and they ate a hearty breakfast Maria watched them, and hated them because they could eat while her 29 By the Light of the Soul mother was so ill Miss Bell also ate heartily, and she felt that...
- 488
- 398
- 0
Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt
... Transformants and revertants were identified by restriction analyses of PCR fragments obtained with primers CarBG-2F (5¢-TGGGCGAGCTCATGAGCGACATTAAGAA ATCTG-3¢) and CarBG-3R (5¢-CGCTCAGAACGACA ... genes carB and carRA Mol Genet Genomics 267, 593–602 22 Prado-Cabrero A, Estrada AF, Al-Babili S & Avalos J (2007) Identification and biochemical characterization of a novel carotenoid oxygenase: ... + carS35 carB+ carS35 carB36 carS35 carB37 carS35 carB38 carB+ ⁄ carB36 hygR carS63 carB+ ⁄ carB36 hygR carS63 carB36 FKMC1995, spontaneous ClO3K resistance SF1, NG mutagenesis SF4, NG mutagenesis...
- 16
- 440
- 0
Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx
... Neu5Aca2-3Galb14GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4Glcb-Cer and NeuAca2-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb13Galb1-4GlcNAcb1-3Galb1-4Glcb-Cer isolated from human gastric adenocarcinoma [40] These findings suggest that ... of each substrate linkages of blood group A and B antigens, Gala1-4Galb14GlcNAc and GlcNAca1-4Galb1-4GalNAc, and GlcAb13Galb1-3Gal structures, respectively The structure of the site of cleavage ... by b3 GnT and b- D-galactosidase or b4 GalT (C) N-acetylglucosaminylation of Galb-pNP by b- N-acetylhexosaminidase-mediated transglycosylation Fig HPLC analysis of the reaction mixture obtained by...
- 11
- 365
- 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... rates [29], stimulation of apoptosis of immature thymocytes [30] TXA2 has been implicated as a mediator of a number of vascular disorders including thrombosis, unstable angina, myocardial infarction, ... 45 by up-regulating the synthesis and release of endogenous basic fibroblast growth factor J Biol Chem 268, 17397–17403 Lianos, E .A & Bresnahan, B. A (1999) Effect of thromboxane A2 inhibition and ... Kinsella, B. T (2002) Regulation of the extracellular signal regulated protein kinase cascades by the a and b isoforms of the human thromboxane A2 receptor Mol Pharmacol 61, 817–831 Hu, S.L & Manley,...
- 16
- 321
- 0
báo cáo hóa học: " Inhibition of the alternative complement activation pathway in traumatic brain injury by a monoclonal anti-factor B antibody: a randomized placebo-controlled study in mice" pot
... pathway activity after traumatic brain injury (TBI) Functional Functional assessment of mAb 1379 on alternative complement pathway activity after traumatic brain injury (TBI) Relative alternative ... B- cells C 3a and C 5a are potent anaphylatoxins with chemotactic and inflammatory properties Generation of C 5b by cleavage of C5 initiates the formation of the membrane attack complex (MAC, C 5b- 9) through ... Svoboda P, Brayley N, Mazairac G, Laloe V, MunozSanchez A, Arango M, Hartzenberg B, Khamis H, Yutthakasemsunt S, Komolafe E, Olldashi F, Yadav Y, Murillo-Cabezas F, Shakur H, Edwards P: Effect of...
- 12
- 465
- 0
Báo cáo khoa học: " A simple and rapid method for detection of Goose Parvovirus in the field by loop-mediated isothermal amplification" pps
... 5’-ggccaaatcctccgagattcgg-cagggacctattggggca -3’ BIP Backward inner (B1 c +B2 ) 40-mer (B1 c:20-nt, B2 :20-nt) 5’-caatccaccaccgcaggtgt-ccacttctggtgcacgtatt -3’ LF Loop Forward 1259 1283 25-nt 5’-TGGAATTTACCATCAGTCTTCGGTA-3’ ... iridovirus by Loop-Mediated Isothermal Amplification J Appl Microbiol 2008, 2:389-97 Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T: Loop-mediated isothermal amplification of ... GPV Veterinary Science in China 1962, 8:19-20, (in chinese) Takehara K, Nishio T, Hayashi Y, Kanda J, Sasaki M, Abe N, Hiraizumi M, Saito S, Yamada T, Haritani M: An outbreak of goose parvovirus...
- 7
- 382
- 0
Báo cáo khoa học: "Clinical significance of 4 patients with chronic hepatitis B achieving HBsAg clearance by treated with pegylated interferon alpha-2a for less than 1 year: a short report" pot
... hepatitis B Characteristics Case Case Case Case Sex Age(yr) Course of diseasea(yr) Therapy Course of treatmentb(wk) HBV DNA undetectablec ALT normalization HBeAg seroconversion HBsAg clearance HBsAg ... help eradicate HBV infectious hepatocytes by dual anti-viral and immunomodulatory mode of action[10] In contrast to nucleoside analogues, pegylated interferon alpha- 2a has a higher rate of HBeAg ... months Among them, serum HBV DNA was arrayed by fluorescent quantitative PCR and HBV markers were arrayed by ELISA Results Therapeutic efficacy Within less than year, serum HBV DNA loss, ALT normalization,...
- 3
- 328
- 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy in that it minimizes bowel leakage [15] Moreover, invagination ... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of the ... incomplete bowel preparation The bleeding was controlled by #3-0 Vycryl intracorporeal suture, and the invagination of the diverticulum was performed laparoscopically The recovery was uneventful, and...
- 3
- 531
- 0
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation
... different samples at various SRT The BOD/COD of influent sample has an average of 0.66 This shows that the denimprocessing wastewater can be classified as rather easily biodegradable waste by aerobic ... tank and a microfiltration membrane as separation apparatus The aeration tank was made from Plexiglas with a working volume of liters Air was supplied to the aeration tank through diffusers at a ... from chemical treatment is classified as a hazardous waste, so it should be treated in a proper way This means that the sludge disposal causes a substantial increase in wastewater treatment cost...
- 8
- 434
- 0
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling
... 19-28 Ishikawa, H., Shimoda, M., Kawano, T and Osajima, Y (199 5a) Inactivation of enzymes in an aqueous solution by micro-bubbles of supercritical carbon dioxide Biosci Biotechnol Biochem., 59(4), ... α-glucosidase, were completely inactivated by the SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated Ishikawa et al (1996) ... microbubble method J Agric Food Chem., 44, 2646-2649 Japan Water Works Association (JWWA) (2001) The method of Japan Water Works Association p.573-613 (in Japanese) Kobayashi, F., Hayata, Y., Kohara,...
- 10
- 451
- 1
A new algorithm for enumeration of minimum cutsets of graph by branch addition
... IEEE Annual Reliability and Maintainability Symposium S Hasanuddin Ahmad, "Simple Enumeration of Minimal Cutsets of Acyclic Directed Graph," IEEE Trans on Reliability, Vol 37, No 5, December 1988 ... No Branch # Branch # Minimum cutset No Branch # Branch # Minimum cutset No Branch # Branch # Minimum cutset No Branch # Branch # Minimum cutset No Branch # Branch # Minimum cutset No Branch # Branch ... R Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus...
- 6
- 545
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu