axial and lateral bearing capacity of piles

... towards  the  center  of plain.  It  is  composed of sand, silt, clay of alluvial facies of Thai  Binh  Formation  (Fig.  2)  in  the  upper  part  and lens  of sand,  silt,  clay  of Hai  Hung  ... widespread in the plain. The third sequence has  a  continuous  change  of facies  from  sand,  silt  and clay  of alluvial  facies  to  clayey  silt  mixed  with  sand  of deltaic  facies  and silty  clay  of lagoonal  facies  in  ... cycle  of Hai  Hung  Formation, composed of greenish gray clay and peat of lagoon and coastal swamp facies.  ‐  The  fifth  sequence  was  formed  in  Late  Holocene  and composed  of sand, ...

Ngày tải lên: 28/03/2014, 15:20

... Tests of Sheikh and Yau [77] 137 Figure 4.8: Stress-Strain Curves of Steel Bars in Tests of Sheikh and Yau [77] 137 Figure 4.9: Stress-Strain Curve of CFRP and GFRP in Tests of Sheikh and ... Ultimate lateral confining pressure ft Tensile stress of concrete fto Modulus of rupture of concrete fs Stress of steel fsy Yield stress of steel fsu Ultimate stress of steel gap Gap between jacket and ... moment P Axial load P0 Initial axial load Pi1 Axial load at first yield state Pi2 Axial load at second yield state Pmax Maximum axial load Pu Ultimate axial load Q Total lateral load Qi1 Total lateral...

Ngày tải lên: 13/11/2014, 10:03

... EFFECTS OF TIME ON CAPACITY OF PILES DRIVEN IN SAND 233 around ten months of their installation The make-up and test histories of the CLAROM piles are detailed in Table tension test and two ‘rapid’ ... first-time and pre-failed tension tests for: (a) control pile C1 and reaction piles R1 and R2; (b) reaction piles R3 and R4; (c) reaction piles R5 and R6; (d) CLAROM piles CS, CL, LS and LL November ... (b) and (c) present traces for each of the GOPAL piles, showing how the (normalised and pile-weight corrected for tension) capacity of pre-failed piles varied with time The fresh piles IAC and...

Ngày tải lên: 13/08/2015, 10:38

... 1.6 Overview of the Sand Compaction Pile Method Materials used and method of installation Use of Sand Compaction Piles Use of Sand Compaction Piles worldwide Use of Sand Compaction Piles in Singapore ... performance of a large floating roof tank, 79m diameter and 14.4m high in India on a stone column foundation The tank overlies a silty sand fill followed by 7m of loose sand/ silty sand and soft clay ... strength of the clay, γs is the unit weight of the sand pile, σ is the vertical stress from the loading z is the depth of the sliding surface, φs is the angle of internal friction of sand and α...

Ngày tải lên: 01/10/2015, 11:39

... time of 2–4 s, and a step and band width of nm, and were averaged over three to five acquisitions The near-UV spectra were recorded at 20 °C with a 1-cm cuvette and a protein concentration of 21 ... of bis-ANS to rsCD1e2) and rsCD1e2+ in one representative experiment at pH 4.5 are shown in the middle and right panels (D) Comparison of the binding of bis-ANS to rsCD1e2 and rsCD1e4, with and ... concentration of 21 lm The spectra were acquired with a scan rate of 50 nmỈmin)1, a response time of s, a step of 0.2 nm, and a band width of nm, and were averaged over 10 acquisitions Buffer spectra were...

Ngày tải lên: 28/03/2014, 22:21

... Number of ply of FRP sheets P Applied axial load Pconf Axial load carrying capacity of confined column Po Nominal axial load capacity of column as per ACI 318-05 Punconf Axial load carrying capacity ... observed axial load capacity for Series I columns Table 3.5b Comparison of predicted and observed axial load capacity for Series II columns CHAPTER Table 4.1 Theoretical predictions of lateral load capacity ... details and results of a study on the FRPconfined capsule-shaped columns subjected to axial and lateral loads The main parameters of the study were the effect of section geometry and the number of...

Ngày tải lên: 09/09/2015, 18:52

... logging and hauling activities One of the criteria considerably affecting erosion is the bearing capacity of soil The bearing capacity of soil can be explained in other words as the capacity of soil ... forest stand usually only once and litter can markedly affect the total bearing capacity of soil The measurement without litter appears to provide a more accurate determination of soil bearing capacity ... frequency of measurements Loadman also facilitates an easier handling of the instrument and an easier interpretation of measuring results and it does not need calibration for each type of material...

Ngày tải lên: 07/08/2014, 10:21

... assessment of the axial capacity of driven offshore piles in siliceous sand The review, which is described in detail in Lehane et al (2005a) and involved the development of an extended database of static ... prediction of axial capacity of driven piles in sand B M Lehane, J.A Schneider and X Xu The University of Western Australia (UWA), Perth ABSTRACT: This paper describes a new method for evaluating the axial ... overpredict the capacity of full scale offshore piles Table 1: Sensitivity of pipe pile capacity to Ar* (Arb* and Ars*) Method for calculation of Ar* Mean Qc/Qm COV for Qc/Qm Open-ended piles in compression...

Ngày tải lên: 13/08/2015, 10:37

... weight of soil κ gradient of swelling and recompression line λ gradient of normal and critical state lines Chapter Vo bearing capacity of spudcan immediately after penetration Vt bearing capacity of ... fitting of bearing capacity with time 144 Table 6-3: Summary table of yield points normalized by initial bearing capacity, VLo, and time-dependent bearing capacity, Vt 145 List of Figures ... between soil and structure η =y/b θ rotational displacement of the footing θ1 angle between longer axis of footing and horizontal component of loading ξ ratio of length and width ρ gradient of shear...

Ngày tải lên: 16/10/2015, 15:38

... effect of biofilm on the adsorption capacity of PAC, PAC covered with biofilm was made and its adsorption capacity was compared to the adsorption capacity of new PAC repeated times For biofilm ... this study is to clarify the effect of DOM and biofilm on the adsorption capacity of PAC in the aeration tank of PACT process Materials and methods 2.1 Operation of powdered activated carbon treatment ... (DOM) and biofilm attached onto PAC However, it is not clear that the effect of DOM and biofilm attached onto PAC were decrease in adsorption capacity of PAC in the aeration tank The objective of...

Ngày tải lên: 05/09/2013, 08:40

... stiffness of the ball screw, ball nut and the rigid bearing The axial dominance of this mode also agrees with Vicente et al (2008), who compared the natural frequencies values from the solutions of axial ... Wide bandwidth control of high-speed milling machine of feed drives, PhD dissertation, University of Florida, 1999 Varanasi, K K and Nayfeh, S A, Modeling, Identification, and Control of Ballscrew ... vibration mode is composed of two kinds of movements: axial and angular According to this, it can be said that each mode function will have two components One of them associated to axial displacement,...

Ngày tải lên: 13/12/2013, 01:16

... presence of CI More precisely, the )21 to )48 and )52 to )87 regions of the top strand and )24 to )53 and )58 to )87 regions of the bottom strand were protected by CI (Fig 3B) The centers of these ... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig ... first base of the start codon of Cro was considered as +1 and the whole sequence was numbered with respect to +1 that the intensities of six bottom strand guanine bases and five top strand guanine...

Ngày tải lên: 07/03/2014, 00:20

... plasmid, and purified as described previously [4] The purity of both apoE3 and apoE4 as assessed by SDS/ PAGE was estimated to be > 98% The molar masses of purified apoE3 and apoE4 (34 245 Da and 34 ... Laue (University of New Hampshire, Durham, NH, USA) and J Philo (Alliance Protein Laboratories, Thousand Oaks, CA, USA) Partial specific volumes () of apoE3 isoforms (0.732 mLỈg)1) and v apoE(263–286) ... curve and shifts to lower values of sf in the presence of peptide are Table Hydrodynamic properties of Myr2Gro-PCho/TO size-fractionated lipid emulsions Lipid emulsions composed of Myr2Gro-PCho and...

Ngày tải lên: 08/03/2014, 09:20

... W366 and Y394 residues of the D2 domain may play a role similar to that of binding sites I and II of GA-1 Mutations of W366 and Y394 in D123 decreased the starch-binding capacity by three- and ... with the pull-down and far western assays, showing a lack of interaction for the individual SBDs and also in the absence of the D(316–344) and D(495–535) regions of the D2 and D3 domains, respectively ... highlighted by black bars (b strand), grey bars (helix) and white bars (coil) D2 and D3 domains are indicated by arrows Stars indicate the positions of W366 and Y394 D(316–344) and D(495–535) regions...

Ngày tải lên: 22/03/2014, 21:20

... the strong generative capacities of CCG and TAG, and the beginnings of a formal comparison between CCG and spinal TAG in terms of Linear Indexed Grammars Induction of dependency trees We now explain ... (t, s) and (t , s ) into a new tree by substituting t into t for some variable x of t, and adding the (appropriately prefixed) list s of nodes of t either before or after the list s of nodes of t ... for their comments The work of Alexander Koller was funded by a DFG Research Fellowship and the Cluster of Excellence “Multimodal Computing and Interaction” The work of Marco Kuhlmann was funded...

Ngày tải lên: 31/03/2014, 20:20

... behavior of the instantaneous channel capacity can be studied with the help of the LCR and ADF of the channel capacity The LCR of the instantaneous channel capacity describes the average rate of up-crossings ... CDF, LCR, and ADF of the channel capacity The mean channel capacity (or the ergodic capacity) can be obtained from the PDF of the channel capacity [27], while the CDF of the channel capacity is ... PDF of the capacity of N ∗Nakagami-m channels Figure 3: The CDF of the capacity of N ∗Nakagami-m channels Figure 4: The mean channel capacity of N ∗Nakagami-m channels Figure 5: The variance of...

Ngày tải lên: 20/06/2014, 20:20

... capacity (or the ergodic capacity) [26], while the CDF of the channel capacity is useful for the derivation and analysis of the outage capacity [26] The mean channel capacity and the outage capacity ... improvement of the system performance [29] Page of 12 The temporal behavior of the channel capacity can be investigated with the help of the LCR and ADF of the channel capacity The LCR of the channel capacity ... channel capacity as from Figures and The LCR NC(r) of the capacity of Nakagami-m channels with MRC and EGC is shown in Figures and for different values of the number of diversity branches L and receiver...

Ngày tải lên: 20/06/2014, 22:20

... selective set of previous nodes in the network and decodes all messages of those nodes Parity forwarding was shown to improve previous decode -and- forward strategies, and it achieves the capacity of new ... auxiliary random variables that indicate partial parts of the messages By this priority, we can achieve the capacity of some other forms of relay networks such as semideterministic and orthogonal ... by Xie and Kumar are specified For the classes of semideterministic and orthogonal relay networks, the proposed achievable rate is shown to be the exact capacity One of the applications of the...

Ngày tải lên: 21/06/2014, 22:20

... restriction of FCC Part 15 rules and a multipath fading channel Figure shows the capacity of PAM over a multipath fading channel with L = and m = 0.65 The capacity of CONCLUSIONS The capacity of UWB ... L = and m = 0.65, while Figure gives the capacity for L = and m = Obviously, the larger L and m, the greater the capacity Figure presents the relationship between reliable channel capacity and ... Figures and show the capacity of the multipath fading UWB channel with continuous inputs and outputs with L = and L = 4, respectively This shows that the capacity increases as m increases, and L...

Ngày tải lên: 21/06/2014, 22:20

... Improve farmers and FCRI staff understanding of the dynamics of both domestic and export markets and the various means farmers have of collectively manipulating the supply of potatoes (and prices) ... much of the work, often as a result of male rural-urban drift The project has effectively targeted women with new techniques and ideas in the areas of crop management, storage and cutting of large ... develop the capacity of the FCRI in a number of key areas: crop management, variety evaluation, agronomy profiling, post harvest and marketing The project has demonstrated the benefits of using...

Ngày tải lên: 22/06/2014, 13:20