aubin penelope c 1685 1731 british author and translator

Tài liệu Charles Carleton Coffin War Correspondent, Traveller, Author, and Statesman doc

Tài liệu Charles Carleton Coffin War Correspondent, Traveller, Author, and Statesman doc

... candidate approached The disruption of the Democratic party at Charleston made the election of the Republican candidate certain "I determined to attend the Convention to be held at Chicago, and ... points was to snap a circuit key the moment the sound reached him In the central office was a chronograph which registered each discharge in succession The distances from each cannon muzzle had ... at critical moments, became slaves to the bottle, and afterwards confirmed drunkards Carleton made no use of tobacco in any form Carleton's wonderful prescience of coming events, and his decisions...

Ngày tải lên: 18/02/2014, 06:20

104 354 0
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

... ADPinduced platelet aggregation Proc Natl Acad Sci USA 95, 8070–8074 ´ Gachet C, Hechler B, Leon C, Vial C, Leray C, Ohlmann P & Cazenave JP (1997) Activation of ADP receptors and platelet function ... thrombin-induced Ca2+ integral with an IC50 of approximately 10 nm and lm, respectively, which is in accordance with the known affinity of these compounds for the PI3-K catalytic subunits At these concentrations ... consent; subjects were free from medication for at least weeks Blood was collected into a : volume of acid-citrate glucose solution (80 mm trisodium citrate, 52 mm citric acid and 180 mm glucose)...

Ngày tải lên: 18/02/2014, 16:20

15 565 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

... treatment can be connected with the facts that modification of particular sites in the genome of living cells is naturally stochastic on the one hand, and influenced by the actual structural and functional ... ‘activated’ forms [33] Recently, it has been reported that accessibility of the p53 CTDBS is critical for (sequence-nonspeci c) cisPtDNA recognition [34] On the other hand, sequencespeci c binding of p53 ... how the checkpoint proteins decide which pathway to activate Particularly, no unambiguous correlation between wild-type p53 expression and cancer cell susceptibility to cisplatin-induced apoptosis...

Ngày tải lên: 19/02/2014, 05:20

14 598 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

... ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ... back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) These primers were designed based on the sequence ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold...

Ngày tải lên: 20/02/2014, 01:20

12 515 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

... 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for ... the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ ... sequence with site-directed mutagenesis Therefore, we used the complementary primers 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All...

Ngày tải lên: 20/02/2014, 02:21

16 408 0
Tài liệu C++ Lab 7 Post-Test and ested Loops pdf

Tài liệu C++ Lab 7 Post-Test and ested Loops pdf

... You can see how simple it is to implement this using a for loop, because they both (inner and outer) are counter-controlled Program 7-4 #include #include using namespace std; ... were to calculate gross pay for an employee as given below) to calculate gross pay for all employees Exit the outer loop when “quit” is entered for the name input Write a program to calculate ... a multiplication table for the number Program 7-2 #include #include using namespace std; int main() { int tableFor =2; int multiplier=1; while (multiplier

Ngày tải lên: 20/02/2014, 08:20

7 385 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... biochemical characterization In conclusion, we have shown that the proposed Mossbauer spectra simulation, based on the actual bio¨ chemical characterization of D desulfuricans ATCC 27774 ccNiR complex ... predicted a lipid attachment to Cys24 The deduced amino-acid sequence of NrfA contains four classical c- type heme-binding motifs CXXCH and a fifth heme-binding site CWXCK [17] The predicted molecular...

Ngày tải lên: 21/02/2014, 00:20

12 594 0
British Government and the Constitution pptx

British Government and the Constitution pptx

... Pol S CFSP CLJ CLP Cm Cmd CML Rev Cmnd COREPER CPAG Crim LR DUP EC ECB ECHR ECJ EEC EHRLR EL Rev EU FPTP HC HC Deb HL HL Deb HRA ICLQ IPPR JHA JLS Advisory, Conciliation and Arbitration Service ... public bodies (i) Control and accountability (g) The civil service (i) The civil service: principles and conduct (ii) Civil servants and ministers (iii) Special advisers Crown and government 366 ... Press xxii Acknowledgements MacCormick v Lord Advocate 1953 SC 396 (Court of Session) Scottish Council of Law Reporting Reproduced from Session Cases® by permission of the Scottish Council of Law...

Ngày tải lên: 07/03/2014, 02:20

903 5,8K 1
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... sequence is identified as Y7.53 Construction of mutated B1wt, B2wt and of the B1 ⁄ B2 receptor chimera Standard PCR techniques using either receptor-speci c or chimeric primers with the B1wt and ... intact cells Biol Chem 385, 835–843 21 Marchese A, Chen C, Kim YM & Benovic JL (2003) The ins and outs of G protein-coupled receptor trafficking Trends Biochem Sci 28, 369–376 22 Kalatskaya I, Schussler ... three times with ice-cold PBS and incubated on ice with 0.15 or 0.3 mL of ice-cold incubation buffer [40 mm Pipes, 109 mm NaCl, mm KCl, 0.1% (v ⁄ v) glucose, 0.05% (v ⁄ v) BSA, mm CaCl2, pH 7.4; degradation...

Ngày tải lên: 07/03/2014, 16:20

12 595 0
C++ Lab 10 Structures (Struct) and Files pot

C++ Lab 10 Structures (Struct) and Files pot

... getline(cin,piece.description); cout>piece.price; void showItem (InvItem piece) { cout

Ngày tải lên: 08/03/2014, 00:20

6 574 1
Victor McLaglen, the British Empire, and the Hollywood Raj: Myth, Film, and Reality pot

Victor McLaglen, the British Empire, and the Hollywood Raj: Myth, Film, and Reality pot

... understand the wide influence of a particular idea of the British Empire, and twentieth-century Hollywood’s depiction of that influence, and shows how fact and fiction can conflate to create ... an officer on the staff of a commander, charged with the maintenance of order and other police functions within a command McLaglen’s most serious task during the war “was to attempt to check the ... appearance was in a 1920 film The Call of the Road, directed by A.E Colby His acting performance was well received, and he quickly became a popular leading man in British silent films such as Carnival...

Ngày tải lên: 16/03/2014, 17:20

24 670 0
Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf

Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf

... range 7.2–115 nM) (C) Complete EPCR ⁄ protein C binding cycle 1, Wildtype sEPCR (800 ng) was injected across the flow cell of a CM5 sensor chip coated with RCR-2 sEPCR was injected for at a flow ... USA) Vector construction and expression of recombinant protein C The full-length protein C cDNA was cloned into the vector pRc ⁄ CMV (Invitrogen, Paisley, UK) to generate 104 Protein C concentrations ... surface of a CM5 sensor chip, and sEPCR captured onto one of the two flow cells of the sensor chip To investigate the nature of RCR-2 binding to sEPCR, recombinant wild-type sEPCR and several sEPCR...

Ngày tải lên: 16/03/2014, 18:20

12 409 0
C#1 introduction to programming and the c language potx

C#1 introduction to programming and the c language potx

... 10 Excellent Economics and Business programmes at: Please click the advert “The perfect start of a successful, international career.” CLICK HERE to discover why both socially and academically ... Perimeter and area of a circle As an example I will show an application, where the user must enter the radius of a circle, and the program calculates and writes the circle’s circumference and area ... text document that contains all the necessary commands his document is called the programs code or source code he individual commands must be written in a very precise way, that the computer can...

Ngày tải lên: 18/03/2014, 02:20

30 539 0
Nicolai josutis   the c++ standard library  a tutorial and reference

Nicolai josutis the c++ standard library a tutorial and reference

... the technical background for this book and the library, such as new language features and the concept of complexity • Chapter 3: General Concepts This chapter describes the fundamental concepts ... the type matches exactly, the implicit copy constructor is generated and called For example: template class MyClass { public: //copy constructor with implicit type conversion //- does ... until a catch clause "catches" and handles the exception: int main() { try { f(); } catch (const Error&) { dyne-book 19 The C+ + Standard Library } //handle exception } Here, any exception...

Ngày tải lên: 19/03/2014, 14:11

642 408 1
Object oriented programming with C++ - Session 3 Function Overloading and References ppt

Object oriented programming with C++ - Session 3 Function Overloading and References ppt

... function is called like func(xobject), while a member function is called like xobject.func() • Designer can select the syntax that is considered most readable Object Oriented Friend classes Declare ... function declaration class first{ public: void display(); }; class second{ public: void display(); }; Object Oriented Scope rules (Contd.) void main() { first object1; second object2; object1.display(); ... Friend classes (Contd.) class beta{ public: void display(alpha d) {cout

Ngày tải lên: 23/03/2014, 04:21

35 688 0
Object oriented programming with C++ - Session 6 Multiple Inheritance and Polymorphism pot

Object oriented programming with C++ - Session 6 Multiple Inheritance and Polymorphism pot

... Programming with C+ + / Session / of 44 Constructors (Contd.) class Teach_asst: public Teacher,public Student { private: int z; public: Teach_asst():Teacher(),Student() //constructor {z = 0;} Teach_asst(int ... • Constructors and Destructors s Use Pointers to Objects to access Member Functions Object Oriented Programming with C+ + / Session / of 44 Session Objectives(Contd.) s Describe Virtual functions ... know which copy is being accessed and hence the error occurs Object Oriented Programming with C+ + / Session / 18 of 44 Virtual Base Classes (Contd.) s s To avoid two copies of the base class we...

Ngày tải lên: 23/03/2014, 04:21

44 540 1
Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc

Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc

... expression constructs encoding the full-length mouse HA-tagged TSSK3 (HA–mTSSK3), the following primer pair was used: primer ⁄ primer (GCGCTGTCGACCATGGAGGACTT TCTGCTCT ⁄ CATTGAATTCCTCAAGTGCTTGCTAGC CATG) ... full-length TSSK3 coding sequence was PCR amplified from a human or mouse testis cDNA, respectively, using oligonucleotide primers GGTGGTCATATGGAGG ACTTTCTRCTCT ⁄ CACTTGCCATTGCTTTTATCA and ligated into ... annealed oligonucleotides into pGEX)6P-1 vector cut with EcoRI, NotI Additionally, oligonucleotides contained KpnI restriction site to select for correct clones The pGEX)6P-1 constructs encoding GST-peptides...

Ngày tải lên: 23/03/2014, 11:20

14 374 0
Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc

Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc

... TTGGCCATATGCAGAAGATCACCGAAGCA ATTCCGGAC ACGGATCCA ATTAATCTC …20 EAMKLVAAAK-31 TCCGGCATATGGAAGCAATGAAGCTCGTC …60 TE-62 TCGCGCATATGACTGAGGATGTTGATGTT (Fig 2A) Each of the c constructs reacted with c antiserum on immunoblots ... following primers: 5¢-GACGGATCC CCATGACCTTAAATCTTTGT-3¢ as the 5¢ primer and 5¢-ATAGTCGACCTGGTTACGAAGAAATCG-3¢ as the 3¢ primer The PCR products were cleaved with BamHI and EcoRI, and cloned into plasmid ... residues (cDN60) Plasmid Amino-acid sequences pET11-cWT pET11-cDN8 ANLRELRDRIGSVKNTQKITEAMKLVAAAK-31 TTTGTCATATGGCAAACCTCCGTGAGC …8RIGSVKNTQKITEAMKLVAAAK-31 GGCCATATGCGGATCGGATCAGTCAAA pET11-cDN12...

Ngày tải lên: 23/03/2014, 13:20

7 290 0
Scientific Database Management (Panel Reports and Supporting Material) ppt

Scientific Database Management (Panel Reports and Supporting Material) ppt

... use and cooperate with real scienti c applications Realistic scienti c problems can best be abstracted from practical scienti c database needs 21 Core Tools Panel members: Vernon Derr, NOAA Nancy ... information such as: who collected the data, when the data were collected, and where the data were collected Characteristics of the device(s) that collected the data Transformation operators (e.g., calibrations) ... access to databases, with advanced systems and methods, to ensure that scienti c users can indeed find relevant databases 2.5 Standards Standards are crucial to all scienti c activity They facilitate...

Ngày tải lên: 23/03/2014, 16:21

95 267 0
Báo cáo khoa học: Disease-related mutations in cytochrome c oxidase studied in yeast and bacterial models pptx

Báo cáo khoa học: Disease-related mutations in cytochrome c oxidase studied in yeast and bacterial models pptx

... enzyme and 6.5 lM cytochrome c2 +, A200T with 0.15 lM enzyme and 5.5 lM cytochrome c2 +, and DF94–F98 with 0.08 lM enzyme and lM cytochrome c2 +, all in 50 lM Hepes/KOH pH 7.4, 45 mM KCl, 44 mM sucrose ... I and III of yeast cytochrome oxidase Biochem J 354, 407–412 Meunier, B & Taanman, J.-W (2002) Mutations of cytochrome c oxidase subunits and in Saccharomyces cerevisiae: assembly defect and compensation ... the catalytic core of cytochrome oxidase Table Disease-related mutations in the mitochondrially encoded subunits of cytochrome oxidase Mutations Disease and references Yeast sequence Effect of...

Ngày tải lên: 23/03/2014, 21:20

9 318 0
w