at cpas mobile equipment activity status

Redeployment Plan for Spectrum Efficient Land Mobile Equipment in the Frequency Range 100-500 MHz pptx

Redeployment Plan for Spectrum Efficient Land Mobile Equipment in the Frequency Range 100-500 MHz pptx

... description of the saturation levels numbered through 5, Level being the lowest spectrum saturation level and Level being the highest spectrum saturation level Table Cell Saturation Level Areas ... activities 3.3 Equipment Certification The radio equipment operating in the bands listed in section 3.1 must be certified under the appropriate equipment standard At the moment, all the relevant equipment ... conservation and efficiency and was stated as follows: Redeployment Plan for Spectrum Efficient Land Mobile Equipment in the Frequency Range 100-500 MHz “Policy Guideline - Spectrum Conservation...

Ngày tải lên: 31/03/2014, 18:20

17 291 0
Mobile money business development at Vietnam mobile service = Phát triển kinh doanh dịch vụ Mobile Money tại công ty Thông tin di động

Mobile money business development at Vietnam mobile service = Phát triển kinh doanh dịch vụ Mobile Money tại công ty Thông tin di động

... System for Mobile communications GSMA: The GSM Association KYC: Know your customer ICT: Information and Communication Technology IP: Internet Protocol MNO: Mobile Network Operator MVNO: Mobile Virtual ... What is Mobile Money? Is it a good opportunity? • What are the models of Mobile money implementation? • What are the key success factors? • Is Mobile money an opportunity in Vietnam for the mobile ... risky initiate with mobile money 1.1.2 What is Mobile money service? Numerous terms are being used to describe the ways mobile phones facilitate financial services like: mobile banking, mobile payments,...

Ngày tải lên: 26/03/2015, 08:55

144 747 2
 Báo cáo y học: "Interference by new-generation mobile phones on critical care medical equipment"

Báo cáo y học: "Interference by new-generation mobile phones on critical care medical equipment"

... demonstrates two new findings in the field of interference by mobile phones on medical equipment First, the 2.5-generation mobile communication network GPRS is able to induce a higher rate of ... 15 Mobile Communications Interference [http:www.mhra.gov.uk/ home/idcplg?IdcServ ice=SS_GET_PAGE&nodeId=261] International Organization for Standardization (ISO): Health Informatics – Use of Mobile ... results at different locations because mobile phones (GSM, GPRS and UMTS) regulate their output power depending on the nearest cell base station for the telecom provider [4,17] If such a station...

Ngày tải lên: 25/10/2012, 10:35

6 509 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... in the cell supernatants (Fig 2C) A lower level of IL-1b was found in the supernatants of cells treated with LF-K518E ⁄ E682G, suggesting that the mutant was defective at activating the inflammasome ... in all three MAPK pathways, LFK518E ⁄ E682G selectively downregulated the ERK pathway To examine why the mutant demonstrated increased specificity in downregulating the ERK pathway, we next compared ... prevent phosphorylation of p38 (Fig 3) indicated that the level of MAPPK3 ⁄ that remained in the cell was sufficient to support maximal p38 phosphorylation We next probed cellular lysates for MAPKK4...

Ngày tải lên: 16/02/2014, 09:20

9 579 0
Tài liệu Báo cáo khoa học: High activity of human butyrylcholinesterase at low pH in the presence of excess butyrylthiocholine pptx

Tài liệu Báo cáo khoa học: High activity of human butyrylcholinesterase at low pH in the presence of excess butyrylthiocholine pptx

... emphasize that the activity that we measure for bkcat does not approach zero at low pH For a titration that ends at zero activity for the fully protonated histidine, theory predicts that at pH unit ... the difference between bkcat and kcat at high pH is large relative to the difference at low pH, and the difference between bkcat at high pH and bkcat at low pH is relatively large (Fig 5) In all ... concentration data (data not shown) The A328W mutant has a remarkable pH vs activity profile (Fig 2, bottom right panel) At low pH, bkcat is larger than kcat, but at high pH bkcat is smaller than kcat...

Ngày tải lên: 20/02/2014, 23:20

10 680 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

... AAAGGTACCAAAGATGTGGAATCTCCTTCACG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT ... AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ... AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC...

Ngày tải lên: 07/03/2014, 15:20

9 415 0
Physical activity and mental health status among elderly people pdf

Physical activity and mental health status among elderly people pdf

... women’s activity level It may be suggested that these data were influenced by cultural questions of conservative education that are still strong in southern Brazil In other words, women are attributed ... “Short-CARE” instrument (Comprehensive Assessment and Referral Evaluation) that had been validated for Portuguese, using the Geriatrics Mental Status (GMS) scale The screening for cognitive deficiency and ... corroborated by the data obtained in the present study, physical activity seems to have a relationship with reduction of the risks of dementia It cannot be stated that physical activity avoids dementia,...

Ngày tải lên: 14/03/2014, 20:20

6 503 0
Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx

Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx

... lyso-PAF AT of cortex or medulla Subcellular localization of lyso-PAF ATs activity Fig Influence of substrate concentration on microsomal lyso-PAF AT activity of human cortex and medulla (A) Activity ... determinations of lyso-PAF AT activity However, this concentration is insufficient for the quantitative precipitation of [3H]-PAF so an excess of BSA (final concentration mg mL)1) was added at the ... the product formation Substrates of lyso-PAF AT When the activity of lyso-PAF ATs was determined at lysoPAF concentrations ranging from to 100 lM at a fixed concentration of acetyl-CoA (200 lM)...

Ngày tải lên: 17/03/2014, 03:20

9 324 0
Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx

Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx

... oligosaccharide substrates by the wild-type and mutant enzymes was determined by HPLC analyses at a single substrate concentration (0.5 mM) at room temperature In these experiments, the secondary attacks on ... binding at the subsites )3 and )4 might be affected by the mutation The relative rate of formation of each product from the hydrolysis of a series of oligomeric substrates has been used to estimate ... mediate the information flow during substrate binding and catalysis [13] The conformation adopted by the loop structure in W58L is another snapshot for different possible conformations that can...

Ngày tải lên: 23/03/2014, 12:20

13 396 0
Mobile Digital Equipment NIJ Standard-0215.01 potx

Mobile Digital Equipment NIJ Standard-0215.01 potx

... the attenuation, keeping the step attenuator approximately at midrange, so that the rf power input to the base station receiver will be dB greater than that required to produce a 12dB SINAD ratio ... the mobile receiver to the base station transmitter through a coaxial cable and attenuators (one a step attenuator) Energize all equipment Adjust the attenuation so that the rf input to the mobile ... and attenuators (one a step attenuator) Energize all equipment Adjust the attenuation s that o the rf input to the base station receiver is mV Adjust the volume and squelch controls to that required...

Ngày tải lên: 23/03/2014, 23:20

28 269 0
Personal protective equipment at work (Second edition) docx

Personal protective equipment at work (Second edition) docx

... PROTECTIVE EQUIPMENT AT WORK REGULATIONS 1992 Regulation Citation and commencement Regulation Interpretation Regulation Disapplication of these Regulations Regulation Provision of personal protective equipment ... Founding) Regulations 1962 Regulation SI 1974/1681; amended by SI 1975/303 The whole Regulations The Aerated Water Regulations (Metrication) Regulations 1981 SI 1981/686 The whole Regulations PART ... and cases of work­related ill health PART GUIDANCE ON THE PERSONAL PROTECTIVE EQUIPMENT AT WORK REGULATIONS 1992 Regulation Citation and commencement Regulation These Regulations may be cited...

Ngày tải lên: 23/03/2014, 23:20

50 474 1
After-hours Power Status of Office Equipment and Inventory of Miscellaneous Plug-Load Equipment doc

After-hours Power Status of Office Equipment and Inventory of Miscellaneous Plug-Load Equipment doc

... actually a conservative estimate Limitations of This Methodology One advantage of conducting after-hours building walk-throughs to collect data on office equipment power status is that more buildings ... laboratory and medical equipment is the largest miscellaneous equipment category in health care buildings and audio/visual equipment is a significant category in education buildings Networking equipment ... Miscellaneous Equipment Miscellaneous equipment outnumbered office equipment in every building except one, at a university (site A); at one medium office (site E), the ratio of miscellaneous equipment...

Ngày tải lên: 23/03/2014, 23:20

33 256 0
Spillovers of Health Education at School on Parents'''' Physical Activity ppt

Spillovers of Health Education at School on Parents'''' Physical Activity ppt

... stated20 stated21 stated22 stated23 stated24 stated25 stated26 stated27 stated29 stated31 stated33 stated34 stated36 stated37 stated38 stated41 stated42 stated43 stated44 stated45 stated47 stated48 ... separated nchildren nchildren2 pclabinc onleave unemployed retired disabled housekeeper student stated2 stated4 stated7 stated8 stated11 stated13 stated14 stated15 stated16 stated17 stated18 stated19 ... health education 10) State adopts a policy stating that newly hired staff who teach health education at the elementary school level will have undergraduate or graduate training in health education...

Ngày tải lên: 28/03/2014, 20:20

32 203 0
Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx

Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx

... for the reactions were calculated Km(ATP) was determined at a saturating concentration (1 lm) of ssDNA, and Km(DNA) was calculated at a saturating concentration of ATP (2 mm) The values obtained ... each case, Vmax (maximal rate of ATP hydrolysis), Km(ATP) (ATP concentration at the half-maximal rate of reaction) and Km(DNA) (DNA concentration at the halfmaximal rate of ATP hydrolysis) for the ... that the protein displayed approximately 30% ATPase activity at °C This suggests that the DNA strand separation assay in vitro probably underestimates RecD helicase activity at lower temperatures...

Ngày tải lên: 30/03/2014, 04:20

17 326 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... promoted transglycosylation even in mM PNPG5, i.e at subsaturating substrate concentration (Km was estimated to be > 10 mM, D Tull and B Svensson, unpublished), while hydrolytic activity of Met53Trp ... enzymes, however, the relative specicity values vary within less than a factor of four and thus indicate that Met53 substitution moderately modulated relative substrate preferences For the ve ... with high activity for insoluble Blue Starch may reect that substrate binds at (an) as yet unidentied site(s) which is (are) situated far from the site of catalysis and can compensate for hampered...

Ngày tải lên: 31/03/2014, 08:20

14 557 0
the role of ''too big to fai'' status in bank merger activity

the role of ''too big to fai'' status in bank merger activity

... studies that “average compliance costs for regulations are substantially greater for banks at low levels of output than at moderate or high levels of output” Such a result implies that regulatory ... TBTF status, or further extend that status, we would expect to see banks engaging in more merger activity than they otherwise would Indeed, the past decade has seen a tremendous wave of consolidation ... regulations (especially in rural states) that were unit banking states By limiting branch banking, and interstate banking, the US was unable to develop any national banks similar to those that...

Ngày tải lên: 03/06/2014, 02:17

160 318 0
Báo cáo sinh học: " Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection" ppt

Báo cáo sinh học: " Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection" ppt

... has been shown to stimulate virus replication by activating viral promotors [16-18] On the other hand, COXs/PGs negatively affect adenovirus replication, as well as replication of human immunodeficiency ... of combined supernatants and cleared cell homogenates from mock-treated (black bars), indomethacin-treated (grey bars) and curcumine-treated (white bars) cultures collected at and h p.i The amount ... after the cells were placed at 37°C This result demonstrates that COX activity plays an important role early in the virus infection cycle, at a postbinding step Thus, COX activity might either be...

Ngày tải lên: 18/06/2014, 18:20

5 449 0
Báo cáo hóa học: " Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection" pptx

Báo cáo hóa học: " Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection" pptx

... has been shown to stimulate virus replication by activating viral promotors [16-18] On the other hand, COXs/PGs negatively affect adenovirus replication, as well as replication of human immunodeficiency ... of combined supernatants and cleared cell homogenates from mock-treated (black bars), indomethacin-treated (grey bars) and curcumine-treated (white bars) cultures collected at and h p.i The amount ... after the cells were placed at 37°C This result demonstrates that COX activity plays an important role early in the virus infection cycle, at a postbinding step Thus, COX activity might either be...

Ngày tải lên: 20/06/2014, 01:20

5 392 0
báo cáo hóa học:" Health status in routine clinical practice: validity of the clinical COPD questionnaire at the individual patient level" potx

báo cáo hóa học:" Health status in routine clinical practice: validity of the clinical COPD questionnaire at the individual patient level" potx

... multidimensional index) was calculated[12] CCQ The CCQ is a 10-item health status questionnaire measuring symptoms, functional status and mental status in patients with COPD The questionnaire ... health status measure, is responsive to treatment and is stable over time if no changes occur [8,9] This article describes the validation, at the individual patient level, of the CCQ Methods Patients ... created containing: i) patient characteristics: gender, age, marital status, forced expiratory volume in one second (FEV1 ) %predicted, body mass index, 6-min walking distance, oxygenation at...

Ngày tải lên: 20/06/2014, 15:20

7 370 0
status of postnatal care among mothers giving birth at the two hospitals in hanoi and an effect evaluation of home-based postnatal care model

status of postnatal care among mothers giving birth at the two hospitals in hanoi and an effect evaluation of home-based postnatal care model

... defensed at Institutional committee in National Institute of Epidemiology and Hygiene at , date month .year 2014 Full dissertation could be found at - National Library - The library of National ... research named: Status of postnatal care among mothers giving birth at the two hospitals in Hanoi and an effect evaluation of home-based postnatal care model" The research is aiming at the followings: ... 1.Descibing status of knowledge, practice and needs of postnatal care among mothers giving birth at National Hospital for Obstetrics and Gynecology and Ba Vi District General Hospital in 2011 3.1.1 Status...

Ngày tải lên: 25/07/2014, 11:36

28 349 0
w