... administrative regions and two from each of the others One facility that was not active was selected from each catchment area At least one nongovernmental or faith-based facility was selected from ... benefited from several ART training initiatives, including the Drug Access Initiative [20], and WHO's Integrated Management of Adult and Adolescent Illness [21], as well as training from organizations ... HealtheFoundation [22], IDI [20,22,23], Mildmay International [20,22], Paediatric Infectious Diseases Clinic at Mulago Hospital, The AIDS Support Organization (TASO) [22], and Uganda Cares These organizations...
Ngày tải lên: 18/06/2014, 17:20
... American Heart Association Statistics Committee and Stroke Statistics Subcommittee: Heart disease and stroke statistics – 2006 update: a report from the American Heart Association Statistics Committee ... determines a unique health state Health states are converted into a weighted health state index by applying scores from the EQ-5D preference weights elicited from general population samples These weights ... factors indicate that female gender and household size of or ≥5 were associated with a negative impact on EQ-5D VAS scores, and female gender and a household size ≥2 were associated with a negative...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Message from the Editor-in-Chief" ppt
... expectations to 679 (180 regular papers, 499 special-issue papers) Receiving these statistics from the Publisher certainly renewed much my own initial enthusiasm about the journal These statistics ... efforts and support, as well as Dr Ahmed Hindawi and his technical staff at Hindawi Publishing Corporation for the wonderful cooperation we have Marc Moonen Editor-in-Chief ... appreciated and crucial to the success of the journal In 2003, EURASIP JASP became one of the first journals to support the “Open Access” model, a new business model for academic publishing that enables...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modified by liming and experimental acidification at the Höglwald site, Germany, from 1982 to 2004" pdf
... concentrations at the limed treatments are still at an average level for German spruce trees [43] This fact indicates a well functioning relocation of P from older to younger needles The limed treatments ... No treatment eect could be observed during the whole investigation period Ca concentrations reached from low to high on the unlimed treatments and from average to very high on the limed treatments ... our data, and no reason is given for a translocation of Mg from older to younger needles Nearly all estimated elemental concentrations showed very high year to year variations, but low treatment...
Ngày tải lên: 07/08/2014, 16:20
Báo cáo y học: "Subtyping patients with heroin addiction at treatment entry: factor derived from the Self-Report Symptom Inventory (SCL-90)" ppt
... DSM-IV criteria and duration of illness of at least year The sample consisted of 1,055 subjects, evaluated at their treatment entry Data came from the Pisa addiction dataset: a database including ... expressed by patients rather than starting from a pre-established syndromic level such as that of the Diagnostic and Statistical Manual of Mental Disorders (DSM) nosography From this foundation, the ... selfevaluation, but this method of evaluation leaves open possible discordance between self-evaluated psychopathology and observer-related 'objective' evaluation for some SCL90 items Given that the...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: " The cnidarian-bilaterian ancestor possessed at least 56 homeoboxes: evidence from the starlet sea anemone, Nematostella vectensis" pdf
... including 130 from the genome of Nematostella, a representative non-bilaterian, 228 from Homo, a representative deuterostome bilaterian, and 97 from Drosophila, a representative protostome bilaterian ... diverges from Bilateria after the origin of homeodomain classes but before their diversification (c) Cnidaria diverges from Bilateria after the diversification of homeobox classes (d) At the time ... (130 from Nematostella, 97 from Drosophila, and 228 from human) Additional data file is a Bayesian phylogeny depicting the relationships among the same 455 homeodomain sequences Additional data...
Ngày tải lên: 14/08/2014, 16:21
27023 a message from an alien
... Now, write the same about you What are you doing… At the moment _ Today ...
Ngày tải lên: 27/08/2016, 21:27
Các phương thức giao dịch Internet banking, sms banking, giao dịch trực tuyến, vietinbank at home
... Nhận thông báo biến động số dư tài khoản • Chuyển khoản ATM hệ thống VietinBank qua SMS CK SMS Banking • Ai sử dụng dịch vụ? Dịch vụ SMS Banking hướng tới phục vụ tất Quý khách sử dụng thuê ... VietinBank đăng ký sử dụng dịch vụ SMS Banking VietinBank sử dụng tiện ích dịch vụ:đăng ký vấn tin tài khoản ATM qua Internet, đăng ký dịch vụ SMS Banking, cập nhật dịch vụ SMS Banking * Các Quý khách ... SMS Banking Tiện ích dịch vụ? •Bất (24 ngày, ngày tuần) dịch vụ SMS Banking VietinBank thông qua tổng đài 8149 cung cấp cho Quý...
Ngày tải lên: 12/03/2013, 16:48
Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana
... 360 310-740 90-310 Table shows the conversion rate of gas production of some substrates at a given retention time at 30oC The values indicate that the longer the retention time, the higher the ... various treatment processes 2.2 KNUST wastewater treatment plant The main sewage pipes connecting facilities on the university campus feed the main pumping station at the entrance of the treatment ... pattern of the estimated flowrate for each month The average daily flowrate of the sludge is 54m3/day Figure shows that between May to August and December to January the monthly sludge flowrates...
Ngày tải lên: 05/09/2013, 16:11
SEND THE RIGHT MESSAGE
... your way Being aware of what is happening in the world keeps you well-informed and also provides you with material for conversation when you have to attend various events that are par for the course ... also important Many a PR professional will have at one time or other find the need to explain advanced technology or intricate financial information to a crowd of laymen, new journalists or even ... lẽ PR chọn lựa lý tưởng cho bạn Today’s professional communicator has to be articulate Being able to convey complex and comprehensive messages to selected audiences is critical to the job Người...
Ngày tải lên: 26/09/2013, 04:10
The research about remodeling and collecting gas from Imhoff tank at Dalat’s sewage treatment factory
... methods of waste water: method of gravity flowing Model is placed negative down, so the water level in the distributing hole higher than model’s water level From then, water flows from Φ 0.5cm pipes ... 2.4.The location of model and the method of operating The location of model: discharge – conditioning valve of Imhoff system tank’s input distributing hole in Da Lat waste water treatment factory ... day from the model Figure Sample chromatograms 3.2 The results of analysis of methane concentration in the gas mixture generated from the model Table The results of analysis of methane concentration...
Ngày tải lên: 18/11/2013, 16:38
Tài liệu Air pollution impacts from carbon capture and storage (CCS) docx
... suitable storage location 14 O2 storage C The transported CO2 has to be stored away from the atmosphere for a long period The rationale behind CCS as a climate change mitigation measure is that CO2 ... dump water from the coal mines to the surrounding groundwater The changes in hydraulic flow patterns could result in impacts such as dry water wells, contaminated groundwater and contaminated ... these, it is expected that saline formations will provide the opportunity to store the greatest Figure 1.5 Indicative transport and storage networks for CO2 at a) intra-Member State and b) EU levels...
Ngày tải lên: 17/02/2014, 10:20
Tài liệu Opportunity for All - How the American Public Benefits from Internet Access at U.S. Libraries pptx
... American Public Benefits from Internet Access at U.S Libraries that result from access to computers, the Internet, and related services at public libraries? What correlations can be made between ... came from the undergraduate Informatics program, as well as from the Master in Library and Information Science and the Master of Science in Information Management Program, and the Information ... demographic variables? What computer and Internet services and resources are lacking at public libraries that, if provided, could bring about greater benefit? What indicators of negative impact can be...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc
... confocal microscope with excitation at 488 nm ⁄ emission at 505–535 nm for green, excitation at 543 nm ⁄ emission at 560–620 nm for red, and excitation at 647 nm ⁄ emission at 660–750 nm for pseudo-color ... estimated from the position of the sedimentation markers Enzymatic activities are expressed in arbitrary units, and representative sedimentation profiles are shown (D) Sections from adult rat tibialis ... The plate was blocked by NaCl ⁄ Pi with 5% fetal bovine serum for h at room temperature Tissue lysates containing equal AChE activity were loaded onto the precoated ELISA plate and incubated for...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc
... 5¢-TGTTAATTAACGAAAATGCTGAAGTGATGTTTT TC-3¢ (forward); 3¢-GAAAAACATCACTTCAGCATTT CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT AATTAACGAAAATAACGAAGTGATGTTTTTCA AC-3¢ (forward); 3¢-GTTGAAAAACATCACTTCGTTA TTTTCGTTAATTAACA-5¢ ... and auto-oxidation rates of Ec DOS PAS, and catalytic activities of full-length enzymes We found that the mutations at Asp40 markedly altered the redox potential and auto-oxidation rate Furthermore, ... ensure that the appropriate temperature of the solution was maintained, the reaction mixture was incubated for 10 prior to spectroscopic measurements Titration experiments were repeated at least...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Si-face stereospecificity at C5 of coenzyme F420 for F420H2 oxidase from methanogenic Archaea as determined by mass spectrometry ppt
... [5-1H2]F420H2 generated from [5-1H]F420 by Mtd-catalysed reduction with [14a-1H2]methylene-H4MPT (Fig 2Ab); and the spectrum of [5-1H]F420 generated from [5-1H2]F420H2 by FprA catalysed oxidation (Fig ... was calculated by the isotope pattern calculator provided by the University of Sheffield at the ChemPuter site (http://www.shef.ac.uk/ chemistry/chemputer/) All calculations of simulated data were ... 2H-labelled substrates showing that the mass spectrum of F420 formed from (5S)-[5-2H1]F420H2 by FprA-catalysed oxidation (c) is identical to the spectrum of [5-1H]F420 (a) The simulated stick spectrum...
Ngày tải lên: 20/02/2014, 03:20
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc
... plot Compound Tat(1–9) Tat(1–9)a Trp1-Tat(1–9) Gly3-Tat(1–9) Ile3-Tat(1–9) Lys2-Tat(1–9) Trp2-Tat(1–9) Trp2-Tat(1–9)* Met-Trp1-G-CSF(1–8) Met-IL-2(1–12) Met-Trp-Val Trp2,Ile3-Tat(1–9) TXA2-R(1–9) ... postulated earlier [30], was demonstrated These interactions might be mainly responsible for the binding of Tat(1–9)-related peptides Furthermore, it could be demonstrated that the protonated, ... the peptides Trp2,Ile3-Tat(1–9), Gly3-Tat(1–9), Ile3-Tat(1–9) and MWV demonstrated that the N-terminal XXP sequence is not the essential structural motif Tat(1–9)-related peptides with the substition...
Ngày tải lên: 20/02/2014, 11:20
Credit at times of stress: Latin American lessons from the global financial crisis pot
... IMF; Datastream; Moody’s; national data; BIS At the regional level, the pre-crisis situation in Emerging Asia and Latin America contrasted with that of Eastern Europe For example, debt ratios ... consider an interest gap, calculated as the deviation of the policy rate from a benchmark rate For the latter we develop a simple signal of unsustainable credit growth; that is, we try to identify ... GDP, the higher the mismatch ratio This partly explains the relatively high mismatch ratios in a number of Latin American countries In other words, the resilience of Latin American countries...
Ngày tải lên: 06/03/2014, 08:20
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx
... conformation, allowing the stabilization of partially folded states that are often not significantly populated under more drastic conditions [15] The inactivation plateau that indicates an intermediate ... that b-glucosidase unfolds at temperatures > 100 °C (at 0.1 MPa) [1,4], the heat denaturation was investigated using the variable-temperature cell, where a low pressure was applied to keep water ... the measurements made at pH 6.0 shows that after pressure treatment at 25 °C, 36% activity was left at 500 MPa, at 40 °C the same activity was still present at 650 MPa, and at 60 °C, 36% residual...
Ngày tải lên: 07/03/2014, 03:20