... Citrate Citrate Citrate – – Citrate 2.1 2.7 2.0 2.5 2.7 1.9 and CoA only and CoA & CoA a It should be noted that, although Arthrobacter DS23R was isolated from a habitat temperature of approximately ... Sulfolobus solfataricus Pyrococcus furiosus Optimum growth temperature (°C) 31 37 55 85 100 a Temperature (°C) at which the half-life equals 45 58 87 95 100 Substrates in crystal structure Data resolution ... contribute, and may reflect the fact that the majority of the substrate-binding and catalytic residues are from the small domain Fig Schematic drawings of CS From top to bottom: ArCS(31), PigCS(37),...
Ngày tải lên: 23/03/2014, 21:20
... expectations to 679 (180 regular papers, 499 special-issue papers) Receiving these statistics from the Publisher certainly renewed much my own initial enthusiasm about the journal These statistics ... efforts and support, as well as Dr Ahmed Hindawi and his technical staff at Hindawi Publishing Corporation for the wonderful cooperation we have Marc Moonen Editor-in-Chief ... appreciated and crucial to the success of the journal In 2003, EURASIP JASP became one of the first journals to support the “Open Access” model, a new business model for academic publishing that enables...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo y học: "Variations in autologous neutralization and CD4 dependence of b12 resistant HIV-1 clade C env clones obtained at different time points from antiretroviral naïve Indian patients with recent infection" doc
... we found that in four patients (IVC3, 4, and 11), Envs obtained at baseline and earlier time points were neutralized by plasma antibodies obtained at later time points, indicating repeated cycles ... enhanced neutralization by b12 MAb It would be important to further investigate the Env sequence that modulated b12 sensitivity in this patient Although we found repeated cycles of escape from autologous ... lowercase in the consensus sequence indicate residues under represented at that position in Envs obtained from all the patients Residues that differed significantly at a particular position were denoted...
Ngày tải lên: 13/08/2014, 01:20
27023 a message from an alien
... Now, write the same about you What are you doing… At the moment _ Today ...
Ngày tải lên: 27/08/2016, 21:27
Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana
... 360 310-740 90-310 Table shows the conversion rate of gas production of some substrates at a given retention time at 30oC The values indicate that the longer the retention time, the higher the ... various treatment processes 2.2 KNUST wastewater treatment plant The main sewage pipes connecting facilities on the university campus feed the main pumping station at the entrance of the treatment ... pattern of the estimated flowrate for each month The average daily flowrate of the sludge is 54m3/day Figure shows that between May to August and December to January the monthly sludge flowrates...
Ngày tải lên: 05/09/2013, 16:11
SEND THE RIGHT MESSAGE
... your way Being aware of what is happening in the world keeps you well-informed and also provides you with material for conversation when you have to attend various events that are par for the course ... also important Many a PR professional will have at one time or other find the need to explain advanced technology or intricate financial information to a crowd of laymen, new journalists or even ... lẽ PR chọn lựa lý tưởng cho bạn Today’s professional communicator has to be articulate Being able to convey complex and comprehensive messages to selected audiences is critical to the job Người...
Ngày tải lên: 26/09/2013, 04:10
The research about remodeling and collecting gas from Imhoff tank at Dalat’s sewage treatment factory
... methods of waste water: method of gravity flowing Model is placed negative down, so the water level in the distributing hole higher than model’s water level From then, water flows from Φ 0.5cm pipes ... 2.4.The location of model and the method of operating The location of model: discharge – conditioning valve of Imhoff system tank’s input distributing hole in Da Lat waste water treatment factory ... day from the model Figure Sample chromatograms 3.2 The results of analysis of methane concentration in the gas mixture generated from the model Table The results of analysis of methane concentration...
Ngày tải lên: 18/11/2013, 16:38
Tài liệu Air pollution impacts from carbon capture and storage (CCS) docx
... suitable storage location 14 O2 storage C The transported CO2 has to be stored away from the atmosphere for a long period The rationale behind CCS as a climate change mitigation measure is that CO2 ... dump water from the coal mines to the surrounding groundwater The changes in hydraulic flow patterns could result in impacts such as dry water wells, contaminated groundwater and contaminated ... these, it is expected that saline formations will provide the opportunity to store the greatest Figure 1.5 Indicative transport and storage networks for CO2 at a) intra-Member State and b) EU levels...
Ngày tải lên: 17/02/2014, 10:20
Tài liệu Opportunity for All - How the American Public Benefits from Internet Access at U.S. Libraries pptx
... American Public Benefits from Internet Access at U.S Libraries that result from access to computers, the Internet, and related services at public libraries? What correlations can be made between ... came from the undergraduate Informatics program, as well as from the Master in Library and Information Science and the Master of Science in Information Management Program, and the Information ... demographic variables? What computer and Internet services and resources are lacking at public libraries that, if provided, could bring about greater benefit? What indicators of negative impact can be...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc
... confocal microscope with excitation at 488 nm ⁄ emission at 505–535 nm for green, excitation at 543 nm ⁄ emission at 560–620 nm for red, and excitation at 647 nm ⁄ emission at 660–750 nm for pseudo-color ... estimated from the position of the sedimentation markers Enzymatic activities are expressed in arbitrary units, and representative sedimentation profiles are shown (D) Sections from adult rat tibialis ... The plate was blocked by NaCl ⁄ Pi with 5% fetal bovine serum for h at room temperature Tissue lysates containing equal AChE activity were loaded onto the precoated ELISA plate and incubated for...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc
... 5¢-TGTTAATTAACGAAAATGCTGAAGTGATGTTTT TC-3¢ (forward); 3¢-GAAAAACATCACTTCAGCATTT CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT AATTAACGAAAATAACGAAGTGATGTTTTTCA AC-3¢ (forward); 3¢-GTTGAAAAACATCACTTCGTTA TTTTCGTTAATTAACA-5¢ ... and auto-oxidation rates of Ec DOS PAS, and catalytic activities of full-length enzymes We found that the mutations at Asp40 markedly altered the redox potential and auto-oxidation rate Furthermore, ... ensure that the appropriate temperature of the solution was maintained, the reaction mixture was incubated for 10 prior to spectroscopic measurements Titration experiments were repeated at least...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Si-face stereospecificity at C5 of coenzyme F420 for F420H2 oxidase from methanogenic Archaea as determined by mass spectrometry ppt
... [5-1H2]F420H2 generated from [5-1H]F420 by Mtd-catalysed reduction with [14a-1H2]methylene-H4MPT (Fig 2Ab); and the spectrum of [5-1H]F420 generated from [5-1H2]F420H2 by FprA catalysed oxidation (Fig ... was calculated by the isotope pattern calculator provided by the University of Sheffield at the ChemPuter site (http://www.shef.ac.uk/ chemistry/chemputer/) All calculations of simulated data were ... 2H-labelled substrates showing that the mass spectrum of F420 formed from (5S)-[5-2H1]F420H2 by FprA-catalysed oxidation (c) is identical to the spectrum of [5-1H]F420 (a) The simulated stick spectrum...
Ngày tải lên: 20/02/2014, 03:20
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc
... plot Compound Tat(1–9) Tat(1–9)a Trp1-Tat(1–9) Gly3-Tat(1–9) Ile3-Tat(1–9) Lys2-Tat(1–9) Trp2-Tat(1–9) Trp2-Tat(1–9)* Met-Trp1-G-CSF(1–8) Met-IL-2(1–12) Met-Trp-Val Trp2,Ile3-Tat(1–9) TXA2-R(1–9) ... postulated earlier [30], was demonstrated These interactions might be mainly responsible for the binding of Tat(1–9)-related peptides Furthermore, it could be demonstrated that the protonated, ... the peptides Trp2,Ile3-Tat(1–9), Gly3-Tat(1–9), Ile3-Tat(1–9) and MWV demonstrated that the N-terminal XXP sequence is not the essential structural motif Tat(1–9)-related peptides with the substition...
Ngày tải lên: 20/02/2014, 11:20
Credit at times of stress: Latin American lessons from the global financial crisis pot
... IMF; Datastream; Moody’s; national data; BIS At the regional level, the pre-crisis situation in Emerging Asia and Latin America contrasted with that of Eastern Europe For example, debt ratios ... consider an interest gap, calculated as the deviation of the policy rate from a benchmark rate For the latter we develop a simple signal of unsustainable credit growth; that is, we try to identify ... GDP, the higher the mismatch ratio This partly explains the relatively high mismatch ratios in a number of Latin American countries In other words, the resilience of Latin American countries...
Ngày tải lên: 06/03/2014, 08:20
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx
... conformation, allowing the stabilization of partially folded states that are often not significantly populated under more drastic conditions [15] The inactivation plateau that indicates an intermediate ... that b-glucosidase unfolds at temperatures > 100 °C (at 0.1 MPa) [1,4], the heat denaturation was investigated using the variable-temperature cell, where a low pressure was applied to keep water ... the measurements made at pH 6.0 shows that after pressure treatment at 25 °C, 36% activity was left at 500 MPa, at 40 °C the same activity was still present at 650 MPa, and at 60 °C, 36% residual...
Ngày tải lên: 07/03/2014, 03:20
SCULPTURE AND INSCRIPTIONS FROM THE MONUMENTAL ENTRANCE TO THE PALATIAL COMPLEX AT KERKENES DAG, TURKEY pot
... FROM KERKENES, TURKEY 52 53 55 57 52 53 B.C 57 B.C B.C B.C B.C 55 B.C B.C B.C B.C oi.uchicago.edu 17 CATALOG: SCULPTURE (CAT NOS 110) Comparative Colossal Statues SUMMARY CONCLUSIONS Comparative ... Claude Brixhe, translated by Catherine M Draycott INDEX OF PLACE NAMES Translated by G PLATES oi.uchicago.edu vii circa, confer, CT Clearance Trench exempli gratia, et alii, and ... Culture, 1050333 B.C The Hattian and Hittite Civilizations Syria Art of the Ancient Near East The Museum of Anatolian Civilizations Aro, Sanna The Luwians Welt des Orient A Catalogue of the Nimrud...
Ngày tải lên: 07/03/2014, 13:20
Excerpt from the Examination Regulations for the Master’s Program in Economics at the University of Mannheim docx
... obtained This statement will also contain the information that the candidate ultimately failed the master’s exam Closing provisions Invalidity of the master’s examination If the candidate cheats during ... of an ultimately failed master’s examination an official notification will be issued In case a candidate has ultimately failed the master’s examination he/she can request a written statement listing ... courses are subject to regulations that are in place at these departments Re-takes Each failed exam from the introductory phase has to be re-taken at the next possible date If the exam was an interim...
Ngày tải lên: 08/03/2014, 05:20
SOUTH AFRICAN MEMORIES SOCIAL, WARLIKE & SPORTING FROM DIARIES WRITTEN AT THE TIME docx
... grievances—their unfair taxation; no education for their children except in Dutch; no representation in Parliament—and this in a population in which, at that time, the English and Afrikanders at Johannesburg ... the celebrated American mining expert This gentleman was a great friend of Randolph's, and he spoke most touchingly of his great attachment to the latter, and of his grief at his death For five ... staring at him with open eyes An attractive attribute was his love of his early associations, his father especially being often the theme of his conversation He used freely to express his admiration...
Ngày tải lên: 15/03/2014, 13:20
Báo cáo khoa học: Nitric oxide formation from the reaction of nitrite with carp and rabbit hemoglobin at intermediate oxygen saturations pdf
... obtain data with Hb O2 saturation (So2) values that covered the full range from 0% to 100% So2 Series investigated the inuence of stabilizing the T state of carp Hb with ATP, which is a natural ... intermediate oxygen saturations, and Hb will never become fully deoxygenated It is therefore important to understand how the reaction of nitrite with Hb proceeds at intermediate oxygen saturations ... Addition of ATP at an [ATP] [Hb] ratio of ([ATP] [Hb4] = 20) increased the P50 of carp Hb to mmHg and the n value to 2.7, showing that ATP both lowered O2 afnity and increased cooperativity Reaction...
Ngày tải lên: 16/03/2014, 06:20