asiapacific region priority act

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

... Triton X-100 on specific inhibitory activity of PAI-1 at 37 8C. The specific inhibitory activity of each variant is given as a fraction of the specific inhibitory activity of the same variant in 1% ... plasminogen activator inhibitor-1; PAI-2, plasminogen activator inhibitor-2; RCL, reactive centre loop; S-2444, L-5-pyroglutamyl-glycyl-L-arginine-p-nitroaniline; uPA, urokinase-type plasminogen activator. Eur. ... uPA. The amount of active PAI-1, and thus the specific inhibitory activity, was calculated from the total amount of PAI-1 that had to be present to inhibit half of the uPA activity in the assays. PAI-1...

Ngày tải lên: 22/02/2014, 07:20

10 431 0
Báo cáo khoa học: The enzyme-binding region of human GM2-activator protein pdf

Báo cáo khoa học: The enzyme-binding region of human GM2-activator protein pdf

... WT activity, whereas the mutants D113K and E123K displayed almost a complete loss of activity. To assess the membrane activity and lipid-binding behaviour of the GM2AP variants, their interaction with ... al. Enzyme-binding region of GM2-activator protein FEBS Journal 273 (2006) 982991 ê 2006 The Authors Journal compilation ê 2006 FEBS 991 The enzyme-binding region of human GM2-activator protein Michaela ... points towards this suggested interaction region, was E123. The long and charged side chain of glutamate is known to be particularly well suited for protein–pro- tein interactions. In contrast, the residues...

Ngày tải lên: 07/03/2014, 12:20

10 430 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

... )72 to )36 contains cis-acting elements necessary for transcriptional activation. To further analyze this region, one copy of a double stranded oligonucleotide spanning the region from )70 to )36 ... located in the region between )134 and )7 0 (Fig. 6). Nuclear factor(s) from X. laevis A6 cells bind within the )70 to )36 bp region of the xMGP promoter Presence of nuclear factors from A6 cells ... transfection. Luciferase activity was assayed as recommended by the manufacturer (Promega) in a ML3000 luminometer (Dynatech). Relative light units were normalized to b-galactosidase activity and protein...

Ngày tải lên: 08/03/2014, 10:20

10 475 0
Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx

Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx

... archaea. Isoenzyme I from Methanothermobacter marbur- gensis 2 was shown to contain a thioxo peptide bond and four methylated amino acids in the active site region. We report here that MCRs from ... the nickel cofactor F 430 [16] and for the post-translational modifications [9] are not yet known [17,18]. Also, the in vitro reconstitution of active enzyme from its subunits and cofactor has proven ... It involves radical intermediates that are very reactive [5,18]. This is probably why the active site of this enzyme is lined up primarily with unreactive aromatic and aliphatic amino acid residues....

Ngày tải lên: 16/03/2014, 05:20

9 549 0
Báo cáo Y học: The inhibitory region of troponin-I alters the ability of F-actin to interact with different segments of myosin pot

Báo cáo Y học: The inhibitory region of troponin-I alters the ability of F-actin to interact with different segments of myosin pot

... N-terminal region of actin [25]. These observations and the fact that only about half of the residues of the IP are required for inhibitory activity suggest that the interaction of only a small region ... fluorescence studies both indicate inter- action of F-actin with another region of myosin, the loop peptide, hcM398–414. The interaction appears to occur at a region on F-actin that is different from that ... interacts with F-actin, the peptides represent- ing presumptive binding regions on myosin and TnI can still bind to actin. This suggests that in the presence of tropomyosin regions of the actin...

Ngày tải lên: 17/03/2014, 10:20

13 524 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

... interacting region in the D2 domain and the lin- ker region connecting CD and SBDs for full SSIII activity. In accordance with our results, it is possible to postulate that a rigid interaction ... physical interaction between the N- and C-terminal domains of SSIII in vitro. Mapping of the CD-binding region in the N-terminal SBDs In order to identify the SBD region required for the SBD–CD interaction, ... D3 domain, are involved in the interaction with CD, and that this interaction enhances the catalytic activity of the enzyme. Our results show that the interaction between SBDs and CD, as well...

Ngày tải lên: 22/03/2014, 21:20

13 457 0
Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

... TGTGGCTCTGTGGAACATTT Sp1FP GGACTACCTGGAGTGATGCCTAA Sp1RP CCCATCAACGGTCTGGAACT AP-2aFP CAACGTTACCCTGCTCACATCA Real-time PCR AP-2a RP CAGGTCGGTGAACTCTTTGCA b-actinFP GCGCGGCTACAGCTTCA b-actinRP CTTAATGTCACGCACGATTTCC Fig. ... promoter region of KCTD10. We found that the proximal promoter region from )108 to +30 was indispensable for basal promoter activity of KCTD10; and SP1 and AP-2a can regulate the promoter activity and ... proximal promoter region stimulated the promoter activity and endogenous KCTD10 expression, whereas binding of AP-2a to this region showed opposite effects. Abbreviations AP-2, activating protein-2;...

Ngày tải lên: 30/03/2014, 02:20

11 409 0
Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

... HP-NAP, Helicobacter pylori neutrophil-activating protein; HP-NAPmut, mutant Helicobacter pylori neutrophil-activating protein; HP-NAPwt, wild-type Helicobacter pylori neutrophil-activating protein; ... Greece Helicobacter pylori neutrophil-activating protein (HP- NAP) is one of the virulence factors produced by the bacterium H. pylori [1]. This protein, originally puri- fied from water extracts of ... Neutrophil activation measured at A 550 nm . , Activation after treatment with polymixin B-coated magnetic beads for LPS removal. , Activation before treatment. , Activation after subtraction of...

Ngày tải lên: 30/03/2014, 04:20

16 352 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

... enzymatic activator is that it should not be transformed during the reaction. In the case of the PC1 ⁄ 3 propeptide, which is implica- ted in active-site folding and inhibition, we showed that, upon activation, ... the enzymatic activity at a proper level. The observed acti- vation may thus be the consequence of an enhanced stability of the 66 kDa form. The CT-peptide is not cleaved by enzymatically active PC1 ⁄ 3 Another ... convertases.) However, the proregion is a potent inhibitor of PC1 ⁄ 3 and binds the active site with nm affinity in vitro resulting in the formation of a stable proregion–enzyme complex [5]. Additional...

Ngày tải lên: 30/03/2014, 08:20

10 305 0
Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx

Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx

... wild-type (wt), or mutated NIS DNAs. After 24 h, b-galactosidase activities were determined as described in Materials and Methods. b-Galactosidase activities are expresse d as OD420. Values are mean ... decrease in iodide uptake activity. b-Galactosidase activities were consistent in w ild-type and mutated NIS-expressing cells, indicatin g that the dramatic reduced iodide uptake activities resulted ... the extracellular region of sodium/iodide symporter are critical for iodide transport activity Chia-Cheng Li 1† , Tin-Yun Ho 1† , Chia-Hung Kao 2 , Shih-Lu Wu 3 , Ji-An Liang 4 , Chien-Yun Hsiang 5* Abstract Background:...

Ngày tải lên: 10/08/2014, 05:21

9 398 0
Rc Actual Test 01.pdf

Rc Actual Test 01.pdf

Ngày tải lên: 07/08/2012, 13:20

27 2,9K 9
Rc Actual Test 02.pdf

Rc Actual Test 02.pdf

Ngày tải lên: 07/08/2012, 13:21

26 2,8K 8
Rc Actual Test 03.pdf

Rc Actual Test 03.pdf

Ngày tải lên: 07/08/2012, 13:25

26 2,1K 6
Rc Actual Test 04.pdf

Rc Actual Test 04.pdf

Ngày tải lên: 07/08/2012, 13:28

28 1,9K 6
Rc Actual Test 05.pdf

Rc Actual Test 05.pdf

Ngày tải lên: 07/08/2012, 13:31

28 1,8K 6
Rc Actual Test 06.pdf

Rc Actual Test 06.pdf

Ngày tải lên: 07/08/2012, 13:35

26 1,3K 4
Rc Actual Test 07.pdf

Rc Actual Test 07.pdf

Ngày tải lên: 07/08/2012, 13:38

26 1,8K 4
Rc Actual Test 08.pdf

Rc Actual Test 08.pdf

Ngày tải lên: 07/08/2012, 13:59

26 1,5K 5
Rc Actual Test 09.pdf

Rc Actual Test 09.pdf

Ngày tải lên: 07/08/2012, 14:02

28 1,2K 3
w