... Triton X-100 on specific inhibitory activityof PAI-1 at 37 8C. The specific inhibitory activity of each variant isgiven as a fraction of the specific inhibitory activity of the same variantin 1% ... plasminogen activator inhibitor-1;PAI-2, plasminogen activator inhibitor-2; RCL, reactive centre loop;S-2444,L-5-pyroglutamyl-glycyl-L-arginine-p-nitroaniline; uPA,urokinase-type plasminogen activator.Eur. ... uPA. The amount of active PAI-1, and thus thespecific inhibitory activity, was calculated from the totalamount of PAI-1 that had to be present to inhibit half of theuPA activity in the assays.PAI-1...
... WT activity,whereas the mutants D113K and E123K displayedalmost a complete loss of activity.To assess the membrane activity and lipid-bindingbehaviour of the GM2AP variants, their interactionwith ... al. Enzyme-binding region of GM2-activator proteinFEBS Journal 273 (2006) 982991 ê 2006 The Authors Journal compilation ê 2006 FEBS 991 The enzyme-binding region of human GM2-activatorproteinMichaela ... pointstowards this suggested interaction region, was E123.The long and charged side chain of glutamate isknown to be particularly well suited for protein–pro-tein interactions. In contrast, the residues...
... )72 to )36contains cis-acting elements necessary for transcriptionalactivation. To further analyze this region, one copy of adouble stranded oligonucleotide spanning the region from)70 to )36 ... located in the region between )134and )7 0 (Fig. 6).Nuclear factor(s) fromX. laevisA6 cells bindwithin the )70 to )36 bp region of the xMGP promoterPresence of nuclear factors from A6 cells ... transfection. Luciferaseactivity was assayed as recommended by the manufacturer(Promega) in a ML3000 luminometer (Dynatech). Relativelight units were normalized to b-galactosidase activity andprotein...
... archaea. Isoenzyme I from Methanothermobacter marbur-gensis2was shown to contain a thioxo peptide bond and four methylatedamino acids in the active site region. We report here that MCRs from ... the nickel cofactor F430[16] and for the post-translational modifications [9] arenot yet known [17,18]. Also, the in vitro reconstitutionof active enzyme from its subunits and cofactor hasproven ... Itinvolves radical intermediates that are very reactive[5,18]. This is probably why the active site of thisenzyme is lined up primarily with unreactive aromaticand aliphatic amino acid residues....
... N-terminal region of actin [25]. Theseobservations and the fact that only about half of theresidues of the IP are required for inhibitory activity suggestthat the interaction of only a small region ... fluorescence studies both indicate inter-action of F-actin with another region of myosin, the looppeptide, hcM398–414. The interaction appears to occur at a region on F-actin that is different from that ... interacts with F-actin, the peptides represent-ing presumptive binding regions on myosin and TnI can stillbind to actin. This suggests that in the presence oftropomyosin regions of the actin...
... interacting region in the D2 domain and the lin-ker region connecting CD and SBDs for full SSIIIactivity. In accordance with our results, it is possibleto postulate that a rigid interaction ... physicalinteraction between the N- and C-terminal domains ofSSIII in vitro.Mapping of the CD-binding region in theN-terminal SBDsIn order to identify the SBD region required for theSBD–CD interaction, ... D3 domain, areinvolved in the interaction with CD, and that thisinteraction enhances the catalytic activity of theenzyme. Our results show that the interaction betweenSBDs and CD, as well...
... TGTGGCTCTGTGGAACATTTSp1FP GGACTACCTGGAGTGATGCCTAASp1RP CCCATCAACGGTCTGGAACTAP-2aFP CAACGTTACCCTGCTCACATCA Real-time PCRAP-2aRP CAGGTCGGTGAACTCTTTGCAb-actinFP GCGCGGCTACAGCTTCAb-actinRP CTTAATGTCACGCACGATTTCCFig. ... promoter region of KCTD10. We found that theproximal promoter region from )108 to +30 wasindispensable for basal promoter activity of KCTD10;and SP1 and AP-2a can regulate the promoter activityand ... proximal promoter region stimulated the promoteractivity and endogenous KCTD10 expression, whereas binding of AP-2a tothis region showed opposite effects.AbbreviationsAP-2, activating protein-2;...
... HP-NAP, Helicobacter pylori neutrophil-activating protein; HP-NAPmut, mutant Helicobacter pylori neutrophil-activatingprotein; HP-NAPwt, wild-type Helicobacter pylori neutrophil-activating protein; ... GreeceHelicobacter pylori neutrophil-activating protein (HP-NAP) is one of the virulence factors produced by thebacterium H. pylori [1]. This protein, originally puri-fied from water extracts of ... Neutrophil activation measured atA550 nm. , Activation after treatment withpolymixin B-coated magnetic beads for LPSremoval., Activation before treatment., Activation after subtraction of...
... enzymatic activator isthat it should not be transformed during the reaction.In the case of the PC1 ⁄ 3 propeptide, which is implica-ted in active-site folding and inhibition, we showedthat, upon activation, ... theenzymatic activity at a proper level. The observed acti-vation may thus be the consequence of an enhancedstability of the 66 kDa form.The CT-peptide is not cleaved by enzymaticallyactive PC1⁄3Another ... convertases.) However, the proregionis a potent inhibitor of PC1 ⁄ 3 and binds the active sitewith nm affinity in vitro resulting in the formation of astable proregion–enzyme complex [5]. Additional...
... wild-type (wt), or mutated NIS DNAs. After 24 h,b-galactosidase activities were determined as described in Materials andMethods. b-Galactosidase activities are expresse d as OD420. Values aremean ... decrease in iodide uptake activity.b-Galactosidase activities were consistent in w ild-typeand mutated NIS-expressing cells, indicatin g that thedramatic reduced iodide uptake activities resulted ... theextracellular region of sodium/iodide symporterare critical for iodide transport activityChia-Cheng Li1†, Tin-Yun Ho1†, Chia-Hung Kao2, Shih-Lu Wu3, Ji-An Liang4, Chien-Yun Hsiang5*AbstractBackground:...