asian honeybees and mitochondrial dna

... preference and amino acid usage are calculated for genes in each isochore and chromosome Table lists the results for the NOR and the mitochondrial DNA insertion isochore in chromosome II and the ... and chromosomes are listed in supplementary Tables S1 and S2 Table shows that the genes in NOR prefer amino acids encoded by GC-rich codons and GC-ending synonymous codons The mitochondrial DNA ... that it is a mitochondrial DNA insertion region [25] This insertion is much larger than any of the previously reported organellar-to-nuclear transfers, and it is 99% identical to the mitochondrial...

Ngày tải lên: 30/03/2014, 20:20

... and acts as a promoter for both the heavy and light strands of the mtDNA, and contains essential transcription and replication elements The D-loop region is a hot spot for mtDNA alterations and ... in both the mtDNA control and coding regions Approximately half of the patients had heteroplasmic mtDNA mutations The human mtDNA is a double stranded circular molecule of 16569 bp and contains ... mutations is still unknown and the impacts of VacA and CagA on the ROS production and mtDNA mutations are poorly understood To investigate the ROS production and mtDNA mutations in the Hp infected...

Ngày tải lên: 25/10/2012, 11:18

... 15 Jazayeri, M., Andreyev, A., Will, Y., Ward, M., Anderson, C.M & Clevenger, W (2003) Inducible expression of a dominant negative DNA polymerase-c depletes mitochondrial DNA and produces a q0 ... CuZnSOD and MnSOD in q+ and q0 cells from osteosarcoma (bone), rhabdomyosarcoma (muscle) and lung carcinoma (lung) mRNA values of CuZnSOD and MnSOD are normalized for ribosomal 36B4 gene and are ... catalase and GPx activity, depletion of mtDNA diminished SOD and GST activities in boneand muscle-derived q0 cells but not in lung-derived q0 cells (Figs 3–6), where SOD (Figs 3–5) and GST (Fig...

Ngày tải lên: 16/03/2014, 18:20

... interactions between mtDNA repair and degradation pathways ROS induce both single-strand and double-strand breaks in mtDNA, as well as abasic (AP) sites and base damage Both base damage and AP sites are ... repair DNA and damaged mtDNA is simply turned over [84,85] However, the lack of experimental support for this hypothesis, and the discovery of mitochondrial repair of oxidative and alkylating DNA ... repair mechanism for mitochondrial DNA in mouse and human cells Basic Life Sci 5B, 589–591 Anderson CT & Friedberg EC (1980) The presence of nuclear and mitochondrial uracil -DNA glycosylase in...

Ngày tải lên: 29/03/2014, 22:21

... Mutations in mitochondrial genes encoded by both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA have been implicated in a wide range of degenerative diseases MtDNA base substitution and rearrangement ... O2•–, along with mitochondrial NO production, reacts with and damages mitochondrial membranes, proteins, and DNA The increased O2•– is also converted to H2O2 by mitochondrial MnSOD, and the excess ... deleterious mtDNA or nDNA mutations in a mitochondrial gene and (2) the age-related accumulation of somatic mtDNA mutations, causing mitochondrial decline, increased ROS production, and apoptosis...

Ngày tải lên: 11/04/2014, 09:51

... (plasma-5) and 12 (SF-5) were spiked with 10 ng of purified mtDNA Statistical analyses Figure Differences between the groups in the levels of PCRamplified mitochondrial DNA in plasma and SF, and in ... bacterial DNA and differs from eukaryotic nDNA in that it is not protected by histones and has a higher frequency of unmethylated CpG motifs We have shown that purified human and murine mtDNAs, as ... possible and apoptotic mechanisms are induced Although both nDNA and mtDNA undergo oxidative damage [4], it is intriguing to note, first, that mtDNA incurs far higher freeradical damage than nDNA...

Ngày tải lên: 09/08/2014, 01:23

... Hind III digested DNA (S ANGER et al., 1982) and Hinc II digested OX174 RF DNA (S al., 1977) were used ANGER et as molecular weight standards for calibration = E Analysis of DNA bands in electrophoresis ... investigate both the genetic diversity between the subspecies and their intra-population polymorphism using mitochondrial DNA (mtDNA) as a probe MtDNA is indeed a useful tool : it is a well characterized ... origin (wild or domestic) and whatever the tissue used to isolate the DNA (liver or kidney and spleen) Consequently every rabbit is heteroplasmic and harbors a population of mtDNA molecules of different...

Ngày tải lên: 09/08/2014, 22:22

... phosphorylation (ATP6, COX1, COX3, CYTB, ND1, and ND2), in which three are relevant to mitochondrial dysfunction Because the expressions of DNA repair and mtDNAencoded genes were found downregulated, ... Donadi E: Efficiency of the DNA repair and polymorphisms of the XRCC1, XRCC3 and XRCC4 DNA repair genes in systemic lupus erythematosus Lupus 2008, 17:988-995 Fernandez D, Perl A: Metabolic control ... the total number of and the proportion of neutrophils was 4,928/mm and 80.0%, respectively (range 1,601 to 9,674/mm3 and 55.2 to 90.1%), while that for lymphocytes was 919/mm and 14.7%, respectively...

Ngày tải lên: 12/08/2014, 15:23

... ismaxiPhylogeneticandthe 2for Figureand haplogroupandAsian mtDNA sequences for pigs 1in in identified A sequencetreeofAfor tablegeographic mtDNAclassification C samples.the classificationS1study mtDNAs motif119 ... network of domestic pig and wild boar mitochondrial DNAs (mtDNAs) belonging to haplogroup D1 based on the sequence variation of control region and coding region fragments The mtDNA control region ... southeast Siberia, and Korea Region SPI (South Pacific Islands) includes South Pacific Islands and the Malay Peninsula Region AN includes feral pigs in Australia and New Zealand 'Other' includes...

Ngày tải lên: 14/08/2014, 08:20

... BFRO010, and 60°C, 30 s for BFRO011 to BFRO018) and DNA extension (72°C, s) Fragment analysis was performed on a 3130xl Genetic Analyzer and genotyped using GeneMapper v4.0 Mitochondrial DNA data ... and angling between 2007 and 2008 (Table and Figure 1) Fin clips were sampled and stored in 96% ethanol Total DNA was isolated from this tissue using the Wizard Genomic DNA Purification Kit (Promega), ... frequency and in the Drina River population with a 40% frequency Haplotypes Da25 and Da24 share synapomorphies at positions 622, 625, 626 and 635, and at position 708 with haplotypes Da22 and Da23...

Ngày tải lên: 14/08/2014, 13:21

... Dissemination Standard (SDDS), and Indonesia and Thailand have established hyperlinks from the IMF Dissemination Standards Bulletin Board (DSBB) to their respective national economic and financial ... declining industries, and establishing firm- and industry-specific export targets Especially in Indonesia, Malaysia, and Thailand government interventions played a much less prominent and frequently ... and liabilities in particular) and fiscal data, and in the financial and corporate sectors The reform efforts have been invaluably aided by the World Bank, with its focus on the structural and...

Ngày tải lên: 22/12/2013, 17:15

... conformations on DNA methylation In this work, the effect of the intercalated [9] (+)-cis-antiB[a]P-N2-dG adduct on the DNA binding and catalytic activity of SssI and HhaI was examined and compared ... residues in the DNA duplexes, and are consistent with a base-flipping model of the dC target residue Binding and methylation studies The interactions of M.HhaI and M.SssI with DNA containing site-specifically ... intercalated into the DNA A Fig Bar graphs representing relative Kd (K rel ) and kcat (k rel ) values for binding and d cat methylation of DNA containing (+)-cis-B[a]PN2-dG and (+)-trans-B[a]P-N2-dG...

Ngày tải lên: 19/02/2014, 00:20

... inheritance of mitochondrial genomes in human cells These may have important implications for mitochondrial dysfunction and mutations in mtDNA associated with mitochondrial diseases and implicated ... 19.4-kb band of linear monomer mtDNA could be detected in the ydc2D DNA sample but a significant amount of mtDNA remained smeared or trapped in the well (lane i) In contrast, XhoI digestion of DNA ... quantitative dot blot hybridization of total DNA, as described in Materials and methods The relative amount of mtDNA was expressed as the ratio between mtDNAspecific and nuclear hybridization signals As...

Ngày tải lên: 20/02/2014, 11:20

... dithiothreitol, 0.1% Chaps and 150 mM NaCl and protease inhibitors [5 lgÆmL)1 pepstatin A, lgÆmL)1 aprotinin, and mM phenylmethanesulfonyl fluoride]) and lysed by three cycles of freezing and thawing in liquid ... with 32 P-labeled mouse cDNA probes for CytOX subunits I, II, IV, Vb and VIIa under standard conditions (Schleicher & Schuell Laboratory Manual) Gel-purified double stranded DNA probes were labeled ... in cells causes (a) progressive decrease in the nuclear and mitochondrial genome encoded mRNAs for CytOX subunits and (b) the nuclear and mitochondrial genes coding for CytOX are coordinately down...

Ngày tải lên: 20/02/2014, 23:20

... Therefore, systemic and extensive investigations are still required to assign universally appropriate parameter sets of the temperature-dependent thermodynamics for the DNA/ DNA and RNA /DNA oligonucleotide ... the present study, we determined the temperatureindependent and temperature-dependent thermodynamic parameters of 24 DNA/ DNA and 41 RNA /DNA oligonucleotide duplexes The heat capacity changes were ... AND METHODS Material preparations DNA and RNA oligonucleotides were synthesized on a solid support using the standard phosphoramidite method with an Applied Biosystems Model 391 synthesizer and...

Ngày tải lên: 22/02/2014, 07:20

... )74G and )76G (bottom strand) and )33G, )35G, )46G, )56G and )68G (top strand) (Fig 3B) All the protected guanine bases except )56G are located in and around O1 and O2 Interestingly, )35G, )41G and ... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig 2A) was synthesized ... performed a DNase I footprinting experiment using 200 nm CI and radioactively labeled O DNA (Fig 2B) The footprints of both the top and bottom strands of O DNA reveal that two regions in O DNA became...

Ngày tải lên: 07/03/2014, 00:20

... [32P]ATP[cP] and polynucleotide kinase DNA polymerase assays A standard reaction (15 lL) contained lm each of the primer and template and mm each of deoxynucleoside triphosphate, DNA polymerase and the ... of DNA repeat sequences DDI-1A and DDI-1B on AAT, CAG and CA repeats are relatively better than for ATT, CTG and GT the labeled primer and the template expansion system implied that template and ... right-handed, hence in the P conformation [14] In order to observe the conformational transitions of DNA directly and to eliminate drug interference, the CD spectra of native DNA and altered DNA, ...

Ngày tải lên: 07/03/2014, 06:20

... Cytoplasmic and mitochondrial taurocyamine kinases Fig Alignment of mitochondrial targeting sequences of vertebrate and invertebrate MiCKs and Arenicola MiTK Sequences correspond to ubiquitous (uMiCK) and ... TKs Results and Discussion Cytoplasmic and mitochondrial isoforms of TK are present in Arenicola brasiliensis We succeeded in amplifying two complete cDNAs coding for TK from the cDNA pool of ... polychaete Neanthes and Nereis, the MiCKs from the polychaete Chaetopterus and Neanthes, LKs from the oligochaete Eisenia and the echiuroid Urechis, and the cytoplasmic muscle CKs from human and the electric...

Ngày tải lên: 07/03/2014, 21:20

... poly (dT) Lanes and 2, control reaction with DNA polymerase a-primase lacking TAg or vice versa; lanes and 4, 0.2 U and 0.4 U of human; lanes and 6, 0.2 U and 0.4 U of murine DNA polymerase a-primase ... support DNA replication of a plasmid carrying the JCV origin Columns and 3, SV40 Tag with human and murine DNA polymerase a-primase, respectively; columns and 5, JCV Tag with human and murine DNA ... with BSA as a standard (Biorad, Munich) DNA polymerase a and DNA primase assays were performed as previously described [34,42,43] Preparation of S100 extracts and replication of SV40 and JCV in vitro...

Ngày tải lên: 17/03/2014, 03:20

... genome [7] The mitochondrial genome, in mammals, is  16 kb in length and encodes 22 tRNA, 13 subunits of the electron transport system and its own 16S and 26S ribosomal RNAs [8] The mitochondrial ... by a single mtDNA base substitution, such as Leber’s hereditary optic nerve atrophy and myoclonic epilepsy and ragged red fiber (MERRF) [14,15]; and (b) diseases caused by large mtDNA deletion ... 222–230 10 Richter, C (1988) Do mitochondrial DNA fragments promote cancer and aging FEBS Lett 241, 1–5 11 Croteau, D.L., Stierum, R.H & Bohr, V.A (1999) Mitochondrial DNA repair pathways Mutat Res...

Ngày tải lên: 17/03/2014, 23:20