array of pointers in c malloc

Naveen toppo, hrishikesh dewan   pointers in c  a hands on approach 2013

Naveen toppo, hrishikesh dewan pointers in c a hands on approach 2013

Ngày tải lên : 19/03/2014, 14:11
... cache memories as they are faster than DRAM. Also, there exist ã dedicated instruction cache and data cache in some architectures, such that instruction code will reside in the instruction cache ... help of function pointers. Chapter 7 is an explanation of usage of the function pointers concept. Chapter 8 contains details about le handling. How le pointers are used to manipulate les using ... on how various kinds of expressions can be used to access a particular index of an array. Chapter 4 contains an explanation of how pointers can be used to initialize static strings and manipulate...
  • 161
  • 1.1K
  • 1
Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients

Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients

Ngày tải lên : 31/10/2012, 17:08
... Digoxin, Serum concentration, Heart failure, Renal clearance 1. Introduction Cystatin C (Cys -C) is a non-glycosylated cationic protein of 13.3 kDa, belonging to the cystatin superfamily of cysteine ... Okumura K. Factors influencing the prediction of steady state concentrations of digoxin. Biol Pharm Bull. 2001; 24(4):403–408. 22. Cockcroft DW, Gault MH. Prediction of creatinine clearance from ... level of Cys -C to diagnose a certain class of heart diseases, including heart failure, has recently been suggested based on the fact that the serum level of Cys -C, not of Cr, was higher in such...
  • 5
  • 523
  • 0
Tài liệu Community Approaches to Child Health in Malawi: Applying the Community Integrated Management of Childhood Illness (C-IMCI) Framework docx

Tài liệu Community Approaches to Child Health in Malawi: Applying the Community Integrated Management of Childhood Illness (C-IMCI) Framework docx

Ngày tải lên : 12/02/2014, 12:20
... Community Approaches to Child Health in Malawi C- IMCI approach and is integrated with the MOH system. In Chitipa district, World Relief and the MOH trained health facility clinicians in IMCI ... planning. Element 2: Increasing appropriate and accessible care and 3. information from community-based providers Community-based providers often are the rst point of contact for both care of sick children ... management of fever, growth monitoring, and insecticide-treated bed net promotion and distribution. The cost of maintaining the C- IMCI benets of community-based models also becomes increasingly...
  • 33
  • 555
  • 0
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Ngày tải lên : 17/02/2014, 14:20
... permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Problem 2-15 Resolve the force F 1 into components acting along the u and v axes and determine the magnitudes of ... permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Since cos 180deg φ − () cos− φ () = , F R F 1 2 F 2 2 + 2 F 1 F 2 cos φ () += From the figure, tan θ () F 1 sin ... by any means, without permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Problem 2-24 Resolve the force F into components acting along (a) the x and y axes,...
  • 1.1K
  • 1.1K
  • 2
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

Ngày tải lên : 19/02/2014, 07:20
... RT-PCR CaMKII CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT 530 RT-PCR COX I CGA GCT TGC TTT ACA TCA GCC TGT GTC ATC TAG GGT GAA GCC 317 Northern blot COX Vb GGC TTC AAG GTT ACT TCG CGG ... TCC ATG GAA GCG GTT ACT CCA GTA TTG 204 RT-PCR GAPDH GAG CTG AAC GGG AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG 429 RT-PCR CaN AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT 205 RT-PCR CaMKII ... at 94 C for 3 min, cDNA was amplified using the optimal number of PCR cycles (midpoint of the logarithmic range). This was 27 cycles (in the case of SERCA 2a), 28 cycles (CaN), 35 cycles (CaMKII)...
  • 13
  • 578
  • 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Ngày tải lên : 19/02/2014, 17:20
... Predicted amino acid sequence of TNSALP (1559delT). A single T deletion in the cDNA at nucleotide 1559 of tissue nonspe- ci c alkaline phosphatase (TNSALP) changes the amino acid sequence at leucine ... [ 35 S]methionine ⁄ cys- teine at 30 C for 90 min in the absence or presence of canine pancreatic microsomal membrane as described previ- ously [14]. Metabolic labelling and immunoprecipitation For ... SCF Fbs2 ubiquitin ligase com- plex, which specifically targets N-linked high-mannose- type oligosaccharide chains of glycoproteins [31]. The involvement of EDEM and ⁄ or SCF Fbs2 in the degrada- tion of TNSALP...
  • 14
  • 445
  • 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Ngày tải lên : 19/02/2014, 18:20
... GCG-3Â and 5Â-CCATCCGAATTCTCACTACACATTGAT CCTAGCA GAAGC-3Â were used for the PCR amplication of the C- terminal region of d1-EGFP corresponding to the mouse ornithine decarboxylase PEST sequence ... 5Â-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3Â and 5Â-CA TGCCAAACGT TCGCGA CCGC CCTGAC GGCGAT TA TCGGAGTTCGGACA-3Â into the unique SpeI restriction site. p13R4-DP was obtained by replacing the B10 tag of the p13R4 construct with annealed ... (amino acids 422–461 [18]). The B10 tag was subsequently added to the resulting plasmid by cloning the following annealed oligo- nucleotides 5Â-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3Â...
  • 14
  • 483
  • 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Ngày tải lên : 22/02/2014, 04:20
... Pharmaceutical Sciences, University of Tokushima, Japan The effect of a-tocopheryl hemisuccinate (TS) on lipo- polysaccharide (LPS)/interferon -c (IFN)-induced nitric oxide production in rat vascular ... amount of PKCa in VSMC. From these results, we concluded that the enhan- cing effect of LPS/IFN-induced NO production was caused by upregulation of PKC in VSMC. Keywords: a-tocopheryl hemisuccunate; ... proliferation of smooth muscle cells through inhibition of protein kinase C (PKC), and the transcription of some genes such as CD36 and collagenase. We are interested in a-tocopheryl hemisuccinate (TS)...
  • 6
  • 494
  • 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Ngày tải lên : 22/02/2014, 07:20
... staining. q FEBS 2001 Site-speci c recombination in chromatin (Eur. J. Biochem. 268) 6261 Use of site-speci c recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi ... potential re-setting of the chromatin structure. Control experiments using cell line TRE2/3R containing one copy of recombined pTRE-RLZ, which was subcloned from Cre-treated TRE2/3 cells, con- firmed ... why simple recombination systems such as Cre and Flp are proficient in eukaryotic chromatin. Keywords: chromatin; DNA reactivity; nucleoprotein com- plex; site-speci c recombination; transcription. Alterations...
  • 7
  • 472
  • 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Ngày tải lên : 07/03/2014, 16:20
... 3–1). References 1 Gether U (2000) Uncovering molecular mechanisms involved in activation of G protein-coupled receptors. Endocrine Rev 21, 90–113. 2 Ferguson SS (2001) Evolving concepts in G protein-cou- pled ... ligand dissociation in intact cells. Biol Chem 385, 835–843. 21 Marchese A, Chen C, Kim YM & Benovic JL (2003) The ins and outs of G protein-coupled receptor trafck- ing. Trends Biochem Sci 28, ... measured in a b-counter after addition of scintillation fluid. Nonspeci c binding was determined in the presence of 5 lm unlabeled agonist and subtracted from the total binding to calculate the spe- cific...
  • 12
  • 595
  • 0
C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

Ngày tải lên : 08/03/2014, 00:20
... discuss with you dealing with array is the card shuffling program. Here we have an array with names of a deck of card. We do not actually shuffle this array, instead we create an array of integers ... calculated by adding all valid scores stored in the array and dividing by the number of scores. The deviation of each score is obtained by subtracting the score from the mean. Since this program ... Vector Class The vector is more flexible than arrays as it can grow in size dynamically. The array can be accessed using the subscript operator just like in array. However, to add an element into...
  • 7
  • 416
  • 1
Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

Ngày tải lên : 08/03/2014, 08:20
... analysis, which could account for the reduction in catalytic activity. In the current study, we have explored the phenomenon of the induction of cellular refractoriness to the ST peptide in Caco2 cells ... of Caco2 cells Cells were washed with NaCl/P i (pH 8.0) containing 1 m M CaCl 2 and 0.5 m M MgCl 2 (NaCl/P i -CM), and then incu- bated in NaCl/P i -CM containing 500 lgặmL )1 sulfo-NHS- biotin ... (which is correlated with removal of the 145 kDa form of GC -C from cells) in HEK293-GC -C cells could be due to lack of a cellular factor that is present in T84 and Caco2 cells, that selectively...
  • 10
  • 427
  • 0
Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx

Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx

Ngày tải lên : 08/03/2014, 16:20
... I282Q (forward), 5Â-CAACGCCCAGCATACCCAGCAGT-3Â for Q404H (forward), 5Â-CAACGCCCAGGCAACCCAG CAGT-3Â for Q404A (forward), 5Â-TGAACCTCAGCT GGCACATCTA-3Â for I282Q (reverse), 5Â-ACTGCTG GGTATGCTGGGCGT-3Â for ... Q285I, 5Â-TCAATGCTCAGCAGACCCAGCGGC-3Â for H407Q, 5Â-TCAATGCTCAGGCCACCCAGCG GC-3Â for H407A. The selection restriction site mutation was created by primer 5Â-GTAGCTGACTGGAGCATG CAT-3Â mutating a unique ... performed in C3 A cells (ATCC, CRL-10741, lot i 1414101) in 6-well plates. C3 A cells were seeded at a concentration of 5 · 10 5 cells in each well and incubated for 24 h at 37 °Cin2mLgrowth medium containing...
  • 9
  • 552
  • 0
The Benefi ts of Biotechnology: Scientifi c Assessments of Agricultural Biotechnology’s Role in a Safer, Healthier World

The Benefi ts of Biotechnology: Scientifi c Assessments of Agricultural Biotechnology’s Role in a Safer, Healthier World

Ngày tải lên : 13/03/2014, 21:57
... sources: Reduction in the use of diesel fuel in biotech crops, due to a reduction in pesticide spray applications and a reduction in plowing. An increase in the amount of carbon held in ... biotech crops could help Africa mirror the substantial increases in crop production seen in India and China. He noted that modern agricultural technologies can multiply crop production per hectare ... without consumer populations needing to remarkably increase their soy intake. Conjugated Linoleic Acid Soybeans Conjugated linoleic acid (CLA) has several benefits for human health including reduced...
  • 28
  • 286
  • 0
Báo cáo khoa học: Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebrafish genome by subfunctionalization of tissue-specific expression doc

Báo cáo khoa học: Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebrafish genome by subfunctionalization of tissue-specific expression doc

Ngày tải lên : 16/03/2014, 22:20
... (crabp1b;3Â-RACE: 5Â-GCTAACAGATCAATAGGCTTC-3Â,5Â-GATTTGAA AGCAAGAGGGTC-3Â;5Â-RLM-RACE: 5Â-TTAGACGC AGCCGCACAAG-3Â,5Â-CGGCCATCGACGGTCTC-3Â). Three 3Â-RACE cDNA and 5Â-RLM-RACE clones of each gene were sequenced ... GenBank acces- sion number BI533516), which had sequence similarity to the mammalian CRABPI cDNA (crabp1a;3Â-RACE: 5Â-CCC AACTTCGCCGGCACCTGG-3Â,5Â-TGAAAGCTCTCG GCGTAAAC-3Â;5Â-RLM-RACE: 5Â-GAGCTTTCAGA AGTTCGTCG-3Â,5Â-GAATCTCCACATGCGGTTTG-3Â) and ... dis- tinctive binding properties have been identified, the cellular retinol-binding proteins (CRBPs) and the cel- lular retinoic acid-binding proteins (CRABPs). CRBPs, including CRBPI, CRBPII, CRBPIII...
  • 11
  • 312
  • 0