... Ago-Ecosystem of Citrus orchard: + Introduction of Citrus orchard ecosystem in the class + Go to the Citrus orchard: Survey, collection the specimens, + Return the room: Drawing and analysis of ... IPM on citrus, Introduce the process of facilitating farmer to conduct VietGAP 16 IPM on citrus continued, Introduce the process of facilitating farmer to conduct VietGAP 17 Recovery management ... implementation of GAP is the main focus of the 3 rd year of the project (2009). However, because of the complexity of the certification process and the existence of a large gap between the reality of...
Ngày tải lên: 21/06/2014, 04:20
... and calculation NC PC NC PC NC 7. Safety and training NC NC NC PC PC 8. Protective clothing NC PC NC PC PC 9. Pre-harvest interval 2 NC PC NC PC PC 10. Residue checking NC NC NC NC NC ... rootstock NC NC NC NC NC 4. Site history and management NC NC NC NC NC 5. Soil and substrate management NC PC NC PC NC 6. Fertiliser usage NC PC NC PC PC 7. Irrigation NC PC NC C NC 8. Crop ... officially registered pesticide only 1 NC PC NC C PC 4. Keep the list of product NC PC NC PC NC 5. Training in pesticide use or advice from qualified advisers NC PC NC C NC 6. Record of...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo khoa học nông nghiệp " Introduction of the principles of GAP for citrus through implementation of citrus IPM using Farmer Field Schools - Milestone 9 Project Validation Report Part 2" doc
... province. The maximum score is 3. Scores of 2.5 and above indicate a high level of confidence (over 80% of total score), scores of 1.5 and below indicate a lack of confidence in the majority of ... indicate a high level of confidence (over 80% of total score), scores of 1.5 and below indicates a lack of confidence in the majority of trainers, while scores between 1.5 and 2.5 indicate ... in improved practices such as disposal of pesticide containers, and increased use of protective clothing. The understanding of some of the major requirements of GAP and of implementation...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo khoa học nông nghiệp " Introduction of the principles of GAP for citrus through implementation of citrus IPM using Farmer Field Schools " MS7 docx
... the effectiveness of FFS in capacity building of all stakeholders taking in account impact of the process of development of new practices, not only the impact of the changed practices itself. ... delta. FFS participant orchards). Reduced pesticide use. Increased food safety and protection of health of farming communities and consumer of fruits. Increased capacity of citrus industry ... 6 T6 1. Checking of record keeping 2. Canker 3. Mulching 1. Monitoring. 2. Spray fungicide (Kocide, Oxyclorua dong, Champion,…) 3. Application of mulch 5. Paiting fugicides Canker...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo khoa học nông nghiệp " Introduction of the principles of GAP for citrus through implementation of citrus IPM using Farmer Field Schools - Project Progress Report 5" doc
... significant economic impact. contributed to significant economic impact. Environmental impacts observed included increased numbers of beneficial arthropods and an increased abundance of fish in canals. ... establishment of GAP collective action and practices. Finally we will present two cases of citrus farmer groups that received GAP certification. These cases illustrate conditions in which GAP implementation ... delta. FFS participant orchards). Reduced pesticide use. Increased food safety and protection of health of farming communities and consumer of fruits. Increased capacity of citrus industry...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo khoa học nông nghiệp " Introduction of the principles of GAP for citrus through implementation of citrus IPM using Farmer Field Schools " MS10 pdf
... workers then conducting FFSs in their local districts. The objectives were achieved through implementation of all the activities documented in the project contract. Details of project implementation ... delta. FFS participant orchards). Reduced pesticide use. Increased food safety and protection of health of farming communities and consumer of fruits. Increased capacity of citrus industry ... Hoa cooperative increased as a result of the conducting of the FFSs and the cooperative also received GAP certification. 10 was developed by trainers specifically for each province. It concentrated...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo khoa học nông nghiệp " Introduction of the principles of GAP for citrus through implementation of citrus IPM using Farmer Field Schools - Milestone 9 Project Validation and Impact Assessment Report Part 1" ppt
... advisers 2 C C C C C 6. Record of use and calculation PC PC PC PC PC 7. Safety and training PC PC PC PC PC 8. Protective clothing PC PC NC PC PC 9. Pre-harvest interval 3 PC PC PC PC PC 10. ... IPM techniques C C C C C 3. Appropriate and officially registered pesticide only 1 PC PC PC PC PC 4. Keep the list of product C C C C C 5. Training in pesticide use or advice from ... PC PC 10. Residue checking NC NC NC NC NC 11. Pesticide storage and disposal NC PC NC NC NC C= comply, PC= partly comply, NC= Not comply 1 Farmers use pesticides officially registered...
Ngày tải lên: 21/06/2014, 05:20
Project Progress Report: " Introduction of the principles of GAP for citrus through implementation of citrus IPM using Farmer Field Schools " potx
Ngày tải lên: 21/06/2014, 06:20
Báo cáo nghiên cứu nông nghiệp " Introduction of the principles of GAP for citrus through implementation of citrus IPM using Farmer Field Schools " pptx
Ngày tải lên: 22/06/2014, 13:20
AN IMPLEMENTATION OF INTRUSION DETECTION SYSTEM USING GENETIC ALGORITHM pptx
... University of Science and Technology, Sylhet, Bangladesh mukit.sust027@gmail.com 3 Lecturer, Department of Computer Science and Engineering, Shahjalal University of Science and Technology, ... attacks. Every attack on a network can comfortably be placed into one of these groupings [21]. Denial of Service (DoS): A DoS attack is a type of attack in which the hacker makes a computing ... Detection rate for each data type can be seen from figure 2. Figure 2. Detection rate for each class Detection rate (DR) is calculated as the ratio between the number of correctly detected...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Characterization of the bioactive conformation of the C-terminal tripeptide Gly-Leu-Met-NH2 of substance P using [3-prolinoleucine10]SP analogues pdf
... Na,Ca,Cb,Cc¢ atoms of the pyrrolidine cycle. v 1 and v 2 torsion angles correspond to the side chain of the prolinoamino acid and are defined by Na,Ca,Cb,Cc and Ca,Cb,Cc,Cd(proR) atoms. Ac-P c 3 Leu-NHMe w, ... energies of ring puckers of P c 3 Leu and P t 3 Leu indicate that the isopropyl substituent destabilizes the Cc-exo conformer [v 1 gauche(–)] in Ac-P c 3 Leu-NHMe and the Cc-endo conformer [v 1 gauche(+)] ... doi:10.1046/j.1432-1033.2003.03665.x cyclic constraint excludes one v 1 gauche rotamer, gauche(+) for cis-prolinoamino acids and gauche(–) for trans-prolinoamino acids, respectively. The C- terminal conformation of SP (H-Arg-Pro-Lys- Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH 2 )...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khóa học: Development of recombinant inhibitors specific to human kallikrein 2 using phage-display selected substrates docx
... rACT 8.20 ,5¢-TACCGCGGTCAAAATCACCCTCC GTTCTCGAGCAGTGGAGACGCGTGA-3¢;rACT 6.3 , 5¢-TACCGCGGTCAAAATCACC AGGAGGTCTATC GATGTGGAGACGCGTGA-3¢;rACT 8.3 ,5¢-TACCGCG GTCAAAATC AGGGGGAGATCTGAGTTAGTGGA GACGCGTGA-3¢;rACT 6.7 ,5¢-TACCGCGGTCAAAAT C AAGCTTAGAACAACATTAGTGGAGACCGCTG A-3¢;rACT 6.1 ,5¢-TACCGCGGTCAAAATCATGACAA GATCTAACTTAGTGGAGACGCGTGA-3¢;rACT 5.18 , 5¢-TACCGCGGTCAAAATCACC GAGCGTGTCTCG CCCGTGGAGACGCGTGA-3¢ ... rACT 8.20 ,5¢-TACCGCGGTCAAAATCACCCTCC GTTCTCGAGCAGTGGAGACGCGTGA-3¢;rACT 6.3 , 5¢-TACCGCGGTCAAAATCACC AGGAGGTCTATC GATGTGGAGACGCGTGA-3¢;rACT 8.3 ,5¢-TACCGCG GTCAAAATC AGGGGGAGATCTGAGTTAGTGGA GACGCGTGA-3¢;rACT 6.7 ,5¢-TACCGCGGTCAAAAT C AAGCTTAGAACAACATTAGTGGAGACCGCTG A-3¢;rACT 6.1 ,5¢-TACCGCGGTCAAAATCATGACAA GATCTAACTTAGTGGAGACGCGTGA-3¢;rACT 5.18 , 5¢-TACCGCGGTCAAAATCACC GAGCGTGTCTCG CCCGTGGAGACGCGTGA-3¢ ... underlined sequ- ences encode new cleavage sites in the reactive site loop), using primers corresponding to the flanking regions: 5¢-TACCGCGGTCAAAATC-3¢ and 5¢-TCACGCGTGT CCAC-3¢. PCR products were digested...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... the use of insecticides is a common practice by farmers to control insect pests. In some cases the efficacy of insecticides was not proven due to misuse and farmer use of insecticides as a preventive ... feedback for each course and the practicals we delivered, we conducted an examination with 15 practical questions covering all training aspects and a class survey with questionnaires of 15 courses ... use insecticides at all (Table 4). This suggests that use of insecticides without monitoring is not successful. Table 4. Comparison of cashew nut yields between orchards with insecticide spray...
Ngày tải lên: 21/06/2014, 05:20
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... 9. Conclusion The proposed activities of the project for the second 6 months have been achieved. The first year TOT training has been successfully conducted since the start of the project. ... management and the control of competitive species of ants in cashew orchards. Because of the positive influence of this project in Vietnam, Charles Darwin University has made another commitment towards ... end of this report. 4. Introduction & Background The aims of this project are to increase cashew yield and improve nut quality. Specific objectives are (1) to conduct TOT training in cashew...
Ngày tải lên: 21/06/2014, 06:20
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
... insecticides, fungicides and chemical fertilizers respectively. For orchards grown from seeds, costs were VND367,096, VND206,722 and VND1,222,886 for insecticides, fungicides and chemical fertilizers ... in small holders’ orchards. Type of fertilizer No. of orchards No. of times /year Period of use Chemical fertiliser only 129 1.6 + 0.6 April-May; September-October Chemical fertilizer & ... Table 6. Comparison of cashew nut yields between orchards with insecticide spray and those without insecticide spray. Mean yield + SD (kg/ha) No. of orchards Tree age (years) Use of fertilizers...
Ngày tải lên: 21/06/2014, 06:20
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
... weaver ants to control the main cashew insect pests. The courses consisted of a series of activities, which included collection of insects in cashew orchards, identification of pests and natural ... Usefulness in cashew orchard management 2.3 Comments on practice 2.9 Amount of time for teaching & discussion 2.9 Amount of time for field practice 3.1 Balance of theoretical and practical ... Usefulness in cashew orchard management 2.6 Comments on practice 3.1 Amount of time for teaching & discussion 2.9 Amount of time for field practice 3.2 Balance of theoretical and practical...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
Ngày tải lên: 21/06/2014, 06:20
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
Ngày tải lên: 21/06/2014, 06:20