around the house c 1 2
Giao an anh 6 standard
... board : ,8, 12 , 52, 10 0, 20 0, 32 , 41, 400 ,17 , 25 ,600 , 900, 10 - Ss choose numbers from the board - T reads : 6 ,25 , 20 0 , 12 ,17 ,400, ,900, 10 , 41, 32 , 10 0 ,600 , 52 - When the students ... Set the scence : picture b Ss repeat , then act out c Numbers : 11 -15 11 : eleven 12 : twelve 13 : Thirteen 14 : fourteen 15 : fifteen Practice: * Picture Drill/ word cards 7+8 ****+ 000 S1 : ... & answer their classmates ages (C4 ) S1 : How old are you? S1: How old is Lan? S2 : Im S2: Shes EX 2: Give some wordcues & practice S1 : How old are you? S2 : Im 12 13 11 14 Production EX...
- 66
- 312
- 0
Giáo Án Unit 6 : Around the house C1 - C2
... c Free practice : Ss are asked to look at the pictures and answer the questions : 1. Where is the chicken ? 2. Where are the mountains ? - It is to the left of the chair - They are behind the house ... house c Which is Tuans house ? A B - The answer : Picture B Tuans house is very beautiful There is a well to the left of the house and there are some flowers to the right of the house c Production ... The teacher has Ss listen to the tape and the three exercises 1. Listen to the tape and say the name of the thing which the boy will take Trang The tape record1 : There are many things on the...
- 9
- 802
- 5
Phrasal Verbs Pre-Inter Advance - Around the house
... 25 -7 -23 -20 ?"says the shopkeeper "We don't sell 25 -7 -23 -20 -23 , madam I can you a 12 -7-9 -23 -14 -1 1 -15 or a 13 -22 -10 -5-6-8 -23 - 12 but I can't sell you a 25 -7 -23 -20 , this is a 20 -11 -14 shop." ... 18 out, 19 down, 20 up, 21 rosy, 22 rain, 23 off Correct order 1d, 2h, 3f, 49, 5c, 6j, 7a, 8e, 9i, 10 1, 11 b, 12 k Phrasal verb and idiom quiz Ij, 2k, 3c, 4b, 5d, 6f, 7a, 8i, 9m, 10 1, l l e , 12 h, ... off, 16 heels, 17 in, 18 out, 19 out, 20 bone, 21 in, 22 into, 23 bush Student B back, up, out, out, hair, on, fish, of, eye, 10 cheese, 11 over, 12 at, 13 round, 14 pregnant, 15 knife, 16 leg, 17 ...
- 15
- 342
- 1
Tài liệu Pests around the house pptx
... Remedy: Control is seldom easy because it is difficult to get the insecticide to the insect The insecticide should have sufficient persistence to kill baby cockroaches as they hatch If this fails call ... about 12 mm long, the Common or Oriental cockroach is about 20 mm long They eat all kinds of food - meat, vegetables, fruit, bread, even paper and leather Cockroaches thrive around heating ducts ... plants They can be found in the homes, but prefer cracks and crevices Their populations will build up around foundations They can produce large populations rather quickly Earwigs can live in...
- 6
- 362
- 0
spanish around the house
... del coche 98 Shopping De compras 10 1 Transactions Las transacciones 10 1 Shopping Vocabulary Vocabulario para hacer las compras 10 3 At the Grocery Store En la tienda de comestibles 10 5 At the ... darles medicina a los niños 12 7 Accidents Los accidentes 12 8 Medical Equipment and Devices Los aparatos médicos 12 9 In an Emergency En una emergencia 13 0 At the Dentist’s Office En el consultorio ... vestir 11 4 Shopping for Clothes Para comprar ropa 11 5 Jewelry Las joyas 11 8 Contents 11 Family Health and Well-Being La salud y el bienestar de la familia xi 12 1 At the Doctor’s Office En el consultorio...
- 300
- 482
- 0
Giáo án Môn Thể Dục lớp 1
... luyện t - trò chơi Ngày soạn: 21 / 12/ 2007 Ngày dạy: 2 619 / 12 /20 07 27 / 12 /20 07 I- M c tiêu - Ôn số động t c thể d c RLTTCB h c Y /c : th c động t c x c tr c - Chơi trò chơi Chạy tiếp s c Y /c : Biết tham ... luyện t - trò chơi Ngày soạn: 14 / 12 /20 07 Ngày dạy: 19 / 12 /20 07 20 / 12 /20 07 I- M c tiêu - Ôn số động t c thể d c RLTTCB h c Y /c : th c động t c x c tr c - Chơi trò chơi Chạy tiếp s c Y /c : Biết tham ... Tuần 11 - Tiết 11 thể d c rèn luyện t - trò chơi Ngày soạn: 16 /11 /20 07 Ngày dạy: 20 /11 /20 07 I- M c tiêu - Ôn số động t c thể d c RLTTCB h c Y /c : th c động t c x c tr c - H c động t c đứng đa chân...
- 66
- 670
- 1
Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx
... twice The 15 N-T2 measurements were made using delays of 15 , 25 (· 2) , 50, 10 0, 15 0, 17 5, 22 5 (· 2) , 300 and 425 ms For the T1 and T2 pulse sequences, the delay between transients was s The 1H -15 N ... MF (20 04) Flexibility in the P2 domain of the HIV -1 Gag polyprotein Protein Sci 13 , 21 0 1– 21 0 7 FEBS Journal 27 5 (20 08) 329 9–3 311 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 3309 Dynamics ... resonance of biopolymer dynamics J Phys Chem 10 0, 13 29 3 13 310 Freed EO (19 98) HIV -1 gag proteins: diverse functions in the virus life cycle Virology 2 51, 1 15 Freed EO & Martin M (20 01) HIVs and their...
- 13
- 421
- 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢-CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), and cloned in pPROTET ... II C AAAGAGATG 1. 50E-008 1. 10E-008 1. 30E-008 1/ ΔF 1. 30E-008 1. 20 E-008 1. 28 E-008 1. 00E-008 25 50 75 10 0 0 .10 0 0.095 0.090 0.085 1. 26 E-008 AAAGACACG Kd=4 nM 0 .10 5 Kd =1. 2 nM 1/ ΔF340 1/ ΔF340 0 .11 0 ... S & Reed JC (20 03) Bifunctional apoptosis 3898 14 15 16 17 18 19 20 21 22 23 24 25 26 inhibitor (BAR) protects neurons from diverse cell death pathways Cell Death Differ 10 , 11 78 11 87 Sakamoto...
- 14
- 393
- 0
Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc
... ( C) kDa P S P S P S NusAHCV-1a Core +1/ S 72 55 28 22 T ( C) NusAHCV-1b Core +1/ S 28 17 11 28 P S P S P S 17 11 C kDa NusAHCV-1a Core +1/ S NusA TEV kDa 72 55 NusAHCV-1b Core +1/ S NusA 28 28 TEV 17 ... volume (mL) C kDa Ponceau Red 28 Anti-Core +1 Anti-Core +1 HCV-1a HCV-1b 17 HPV E6 HCV-1b Core +1/ S HPV E6 HCV-1b Core +1/ S HCV-1a Core +1/ S HPV E6 HCV-1b Core +1/ S HCV-1a Core +1/ S 11 vent In a second step, ... 11 4 G 22 G 22 S 41 Without OG S 12 S45 S48 S54 S55 T26 V29 M1 Q9 M3 V16 W6 D10 R31V 21 V 32 M25 L20 R4 F 52 R 42 R53 V35 W49 S3 R36 A5 A44 I39 C1 3 A43 A23 I33 A2 W34 A56 With OG 6% 11 8 V 21 122 V35 12 6...
- 16
- 498
- 0
C#1 introduction to programming and the c language potx
... the C# language 11 Contents Inheritance 10 0 Points 10 0 Persons 10 2 12 he class Object 10 9 13 Abstract classes 11 3 Abstract points 11 3 Loan 11 5 Interfaces 12 2 Points again 12 2 Money 12 3 Static ... types 16 4 he class Set 16 6 21 Exception handling 17 4 22 Comments 18 1 23 Extension methods 18 7 Part Collection classes 19 0 24 List 19 2 A List of strings 19 2 Enter sale of products 19 4 Stack ... files 22 2 Write and read text 22 2 Write a comma separated ile 22 5 Read a comma separated ile 22 9 Binary files 2 31 Print 10 0 numbers in a il 2 31 Read a binary ile 23 2 Seek 23 3 27 29 Please click the...
- 30
- 538
- 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot
... CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG ... GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV -1 core ⁄ core +1 sequence that is contained within nucleotides 590– 825 , ... core CMV del core nts 3 42- 514 (a) CMV nt 825 myc( +1) nt 345 pHPI -15 07 nt 825 core +1 nt 515 nt 825 myc( +1) core +1 (b) nt 515 core +1/ S–myc pHPI -14 94 myc( +1) core CMV pHPI -14 95 nt 825 core +1 myc...
- 18
- 365
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... Health Research (MOP-74479) 11 12 13 References Eggelkraut-Gottanka R & Beck-Sickinger AG (20 04) Biosynthesis of peptide hormones derived from precursor sequences Curr Med Chem 11 , 26 51 26 65 Taylor ... 15 184 15 188 17 Muller L & Lindberg I (19 99) The cell biology of the prohormone convertases PC1 and PC2 Prog Nucleic Acid Res Mol Biol 63, 69 10 8 18 Khan AR & James MN (19 98) Molecular mechanisms ... studying the substrate specificity of human prohormone convertase PC1 and human furin and designing a potent irreversible inhibitor J Biol Chem 27 0, 19 22 5 19 2 31 FEBS Journal 27 4 (20 07) 34 82 34 91 ª 20 07...
- 10
- 305
- 0
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot
... GATCGAATTCTGAGCGACATGAAGGCGGAC, GATCGAATTCTAGCGGACGTGACCCGCCTG, GATCGAATTCCCATCGCAGCCCGCCTTCAGATG, GATCGAATTCTCAGCCGGCTGGCCAGCA, GATCGAATTCCTCACCCCACACCGGCCTAC, GATCGAATTCCCTACGCTACACCTCCG, GATCGAATTCTGGCCGCCGCAGGC, ... GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC GATCGAATTCGAGAGACTGGAAGGCAAAG GATCGGATCCTCATTTGCCTTCCAGTCTCTCAG GATCGGATCCTCAGCTGGAGAAATAAC ... GATCGAATTCTGGCCGCCGCAGGC, GATCGTCGACTCATGCAGGCATCTGGCTGTAATTG GATCGTCGACTCAGCTGCGCTCGGACATCTGAAGGC GATCGTCGACTCATATTCGGGACAGCGTGGCTG GATCGTCGACTCACGCCTTCATGTCGCTCAGCAAC GATCGTCGACTCA CTC CTC CAG CTG GTT CAG AAC CTT G...
- 15
- 323
- 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... 0.5 14 .8 ± 1. 2 11 .0 ± 2. 5 6.0 ± 1. 3 10 HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT553A rHPIV1 -C 17 0 rHPIV1-LY942A rHPIV1-CR84GHNT553ALY942A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/ 17 0HNT553ALY942A rHPIV1-CR84G/ ... 0 .1 ≤0.5 ± 0.0 26 .4 ± 1. 5 21 . 0 ± 1. 7 10 .5 ± 0.9 14 .8 ± 1. 9 16 .9 ± 0.7 12 .9 ± 1. 0 8.6 ± 1. 8 5.9 ± 0.5 6.3 ± 0.5 12 .2 ± 1. 6 11 .7 ± 2. 5 14 .3 ± 1. 1 5 .1 ± 0.8 8.4 ± 1. 2 5 .1 ± 0.6 3 .2 ± 0.6 2. 6 ± 0 .1 ... at the indicated temperature compared to 32 C c Virus a 2e 3e 4e 6e HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT553A rHPIV1 -C 17 0 rHPIV1-LY942A rHPIV1-CR84GHNT553ALY942A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/...
- 13
- 504
- 0
Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx
... 0.5 14 .8 ± 1. 2 11 .0 ± 2. 5 6.0 ± 1. 3 10 HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT553A rHPIV1 -C 17 0 rHPIV1-LY942A rHPIV1-CR84GHNT553ALY942A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/ 17 0HNT553ALY942A rHPIV1-CR84G/ ... 0 .1 ≤0.5 ± 0.0 26 .4 ± 1. 5 21 . 0 ± 1. 7 10 .5 ± 0.9 14 .8 ± 1. 9 16 .9 ± 0.7 12 .9 ± 1. 0 8.6 ± 1. 8 5.9 ± 0.5 6.3 ± 0.5 12 .2 ± 1. 6 11 .7 ± 2. 5 14 .3 ± 1. 1 5 .1 ± 0.8 8.4 ± 1. 2 5 .1 ± 0.6 3 .2 ± 0.6 2. 6 ± 0 .1 ... at the indicated temperature compared to 32 C c Virus a 2e 3e 4e 6e HPIV1 wt rHPIV1-CR84G rHPIV1-CR84GHNT553A rHPIV1 -C 17 0 rHPIV1-LY942A rHPIV1-CR84GHNT553ALY942A rHPIV1-CR84GL 17 10 11 rHPIV1-CR84G/...
- 13
- 520
- 0
what a world 1 - amazing stories from around the globe
... on the farm is the cow The cow helps on the farm in two ways It gives milk to the family, and it works on the farm The farmers not make a lot of money They can't buy machines to help them their ... at certain times of the year At these times, people wash and decorate their cows Americans like to wash their cars, and Indians like to wash their cows! Two times a year, there are special celebrations ... ground, but a cow can work Cows also not cost a lot of money They don't need gasoline or repairs like machines Farmers care about their cows very much They want their cows to be happy The farms aren't...
- 139
- 1,189
- 2
![[Thể Dục Thể Thao] Nghệ Thuật - Kĩ Thuật Đá Cầu Phần 1 ppt](https://media.store123doc.com/images/document/2014_07/28/small_kvt1406510422.jpg)
Learn Objective C on the Mac phần 1 pdf
... C HAPTE R 13 20 2 20 3 20 4 20 6 20 8 21 2 21 4 21 4 21 5 21 7 21 8 21 8 22 0 2 21 2 21 22 2 22 6 22 7 22 7 22 8 2 31 23 2 23 3 23 4 Protocols 23 5 Formal Protocols ... Cheat Sheet Summary C HAP TER 10 8 10 8 11 3 11 3 11 4 11 5 11 5 11 6 11 8 12 1 12 1 12 2 12 3 12 3 12 3 12 4 ... C HAP TER 17 24 9 25 2 25 3 25 6 25 8 25 8 26 0 26 2 26 4 27 7 28 0 2 81 28 2 28 4 28 8 29 0 29 2 29 2 29 4 NSPredicate 29 5 Creating a Predicate ...
- 37
- 494
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008