... acute liver poisoning or hepatitis, as only a small increase in serum alanine aminotransferase, a larger increase in alkaline phosphatase, and a decrease in aspartate aminotransferase were observed ... be a significant source However, groundwater and surface water are also liable to contamination and will contribute to the intake In the particular case of the cyanobacterial toxins, surface water ... national health agencies set up safe drinking water guidelines for contaminants in a manner parallel to the USEPA The WHO’s Guidelines for Drinking Water Quality were generally followed as a...
Ngày tải lên: 11/08/2014, 17:22
... Similar dynamics also characterize, for instance, Canada and Australia.24 In particular, the Australian saving rate has been negative since 2002 Furthermore, the Canadian personal saving rate appears ... percentage points) can be explained by increases in medical care expenditures This may reveal that consumption has increased simply because social programs are in fact assumed to be paying for the additional ... personal saving rate.8 NIPA Measures of the Personal Saving Rate and (Realized) Capital Gains Distortions are likely to be caused because NIPA conventions exclude (realized and unrealized) capital...
Ngày tải lên: 16/02/2014, 11:20
My idea: is it a business? pptx
... a business succeeding and failing Being a small inventor can be a lonely business, and making a business from your ideas can be frustrating and sometimes painfully slow Because of this, it can ... one company and one research-based organisation Large and small UK companies and even multinational companies can take part (www.ost.gov.uk/link/) Tax relief and allowances for research and development ... contact other inventors to share ideas, advice and opinions There are a number of online forums that allow users to swap ideas and information, such as IPR Talk (www.iprtalk.co.uk), Make Sparks...
Ngày tải lên: 29/03/2014, 18:20
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' ... siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3' ... siRNA1 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3'...
Ngày tải lên: 09/08/2014, 10:23
Bóa cáo y học: " Early apoptosis of blood monocytes in the septic host: is it a mechanism of protection in the event of septic shock" ppt
... Jr, Amado VM, Caserta R, Dalla Valle Martino M, Pasternak J, et al.: Ventilator associated pneumonia: comparison between quantitative and qualitative cultures of tracheal aspirates Crit Care ... pointed towards a predominance of Gram-negative bacteria as responsible pathogens and towards a monomicrobial cause of VAP (Table 1) It was proved that apoptosis is a phenomenon taking place in ... F, Franceschini B, Berger P, Arnal JM, Gainnier M, Sainty JM, Papazian L: Early antibiotic treatment for BAL-confirmed ventilator-associated pneumonia A role for routine endotracheal aspirate...
Ngày tải lên: 12/08/2014, 23:23
Gamma glutamyltransferase is it a biomarker of oxidative stress
... proportionate increase in GGT than in aspartate transaminase (AST) or alanine aminotransferase (ALT) as shown in figure 1.10.3.1 below 26 Figure 1.10.3.1 The graph was taken from Nagaya et al.139 and ... single precursor protein that is catalytically inactive83, which undergoes an autocatalytic process into a heavy and light chain84 The heavy chain, which has the aminoterminal sequence, has a ... with an initial decrease in intracellular glutathione and an increase in GGT mRNA and protein Another study was done with high oxidative stress using hypoxanthine and xanthine oxidase on rat epididymis...
Ngày tải lên: 06/10/2015, 21:29
Tài liệu Is It the Network? Solving VoIP Problems on a Wireless LAN ppt
... slowing the entire network down to far less than 20 Mbps of aggregate bandwidth Even if you have a network where all stations transfer data at a 54 Mbps data rate, calculating VoIP capacity based ... handsets are roaming The problem is that roaming times vary, depending on a variety of factors Network traffic, RF interference, and device processing are three of the many factors that can cause ... that supports WMM, converged voice and data networks are enhanced Instead of worrying that a spike in Wi-Fi usage will cripple VoIP calls, network administrators can take solace in the fact that...
Ngày tải lên: 24/01/2014, 09:20
Báo cáo khoa học: "WHAT A TYPE OF INTERACTION IS IT TOBE HT" potx
... we are at a very general tevel of discourse The real pay-offs, however, w i l l come from discussing specifics For t h a t , i n t e r a c t i o n w i l l be needed, rather than position papers...
Ngày tải lên: 24/03/2014, 01:21
Information security audit (IS audit) - A guideline for IS audits based on IT-Grundschutz pptx
... Association (ISACA), and international organisations such as the International Auditing and Assurance Standards Board (IAASB) or the Institute of Internal Auditors (IIA) These publications take ... confidentiality of the information obtained during an audit and the discreet handling of the results and findings of the IS audit are an important basis for such work IS auditors are aware of the value ... between IS cross-cutting audits and IS partial audits An IS cross-cutting audit has a holistic approach and a wide range of tests and examinations In an IS cross-cutting audit, all layers of the IT-Grundschutz...
Ngày tải lên: 29/03/2014, 22:20
Khắc phục lỗi “Your profile can not be used because it is from a newer version of Google Chrome” ppsx
... Trong viết sau, thảo luận cách khắc phục vấn đề Mở Windows Explorer chuyển tới đường dẫn: C:UsersYOURUSERNAMEAppDataLocalGoogleChromeU ser DataDefault (thay YOURUSERNAME với tên tài khoản ... hidden, files folder and drives): Tìm đến file web data x a file này: Lưu ý không thực chắn làm thao tác này, đổi tên file thành web data.bk Sau khởi động Google Chrome, bạn thấy thông báo lỗi ... thống): Chuyển sang chế độ hiển thị tất file ẩn hệ thống mục Folder Options (Start > Folder Options > Folder Options > View > Hidden files and folders > Show hidden, files folder and drives): Tìm...
Ngày tải lên: 12/07/2014, 16:20
Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot
... tenting angle and valve tenting area were meaured using standard approaches in 2D from the vertical and horizontal long-axis Statistics Continuous variables were reported as mean ± SD Categorical ... the signaling pathway presiding over myocyte and sarcomeres appears distinct and expressed at dissimilar rates resulting in asymmetrical LVH normalization post-AVR mRNA signaling following abrupt ... velocity mapping to formally quantitate the mean and peak transvalvular gradients, they were 53 and 78 mmHg, respectively; severe AS Page of variance (ANOVA) and repeated-measures ANOVA was performed...
Ngày tải lên: 10/08/2014, 09:21
cáo khoa học: " Why is it difficult to implement e-health initiatives? A qualitative study" ppsx
... company; General Manager of Health Board Senior Management Clinical Lead for Hospital Trust Clinical Lead for Hospital Trust IT Manager Health Board; Clinical Services Manager Middle Management ... implementation of the Choose and Book (C&B) system in a hospital trust serving an inner city population in a large metropolitan area in England and the lead Primary Care Trust providing referrals ... Primary care: GPs, administrative staff Secondary care: Consultants, outpatient administrative staff Doctors, radiologists, radiography administrative staff Community nurses district nurses in an...
Ngày tải lên: 10/08/2014, 10:23
Bóa cáo y học: "Clinical review: Thyroid hormone replacement in children after cardiac surgery – is it worth a try" docx
... aggravates partial hypopituitarism and SES in critically ill infants and children Iodinated antiseptics in cardiac surgery Infants may absorb significant quantities of iodine in iodinated topical ... for inotropic agents and mechanical devices, decreased the incidence of myocardial ischaemia and decreased the incidence of atrial fibrillation and pacemaker therapy Carrel and colleagues in seven ... patients and were able to correlate a single measurement of low TSH in individuals aged 60 years and older with increased mortality from all causes and in particular mortality due to circulatory...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "Case report of right hamate hook fracture in a patient with previous fracture history of left hamate hook: is it hamate bipartite" pps
... complete fractures, CT clearly reveals an osseous fragment demonstrating indistinct and irregular apposing cortical margins separated from the parent bone [14] Incomplete fractures exhibit partial cortical ... and joint disorders Philadelphia (PA): WB Saunders; 2002:2847-2848 Greenspan A: Orthopaedic Imaging: A practical approach Philadelphia (PA): Lippincott-Williams-Wilkins; 2004:191-195 Norman A, ... trauma or surgery to the wrist [10] In our case, there was a denial of traumatic golf injury to the right wrist but was apparent in the left Features of hamate bipartite Features of hamate bipartite...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "Long-term outcome of a randomized controlled universal prevention trial through a positive parenting program: is it worth the effort" pot
... not participate in a parent training did self-evaluate repeatedly and might have concluded that they not so badly Single parents in the intervention group may, in contrast, felt challenged in the ... the acquisition of data and supervision of data collection as well as to analyzing the behavior observation data All authors read and approved the final manuscript Acknowledgements This study was ... child's and their own behaviour In dual-parent families, both parents were invited to participate in program sessions However, since children did not attend the trainings, dual-parent families usually...
Ngày tải lên: 13/08/2014, 18:21
Báo cáo y học: "Medical emergency motorcycle – is it useful in a Scandinavian Emergency Medical Service?" docx
... such instances a MEM paramedic can assist the paramedics from the car ambulance, or vice versa In this study the MEM assisted car ambulances in 17 instances of cardiac arrest and the MEM paramedic ... medical interventions in 121 patients before the arrival of another ambulance Intravenous drugs were given in 63 cases, including 23 cases of naloxone administration to heroine intoxicated patients ... than for other vehicles Collaboration between at least two health care professionals is important in conditions like cardiac arrest That fact is not, however, an argument against MEM since in...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: " Non-operative management of blunt abdominal trauma. Is it safe and feasible in a district general hospital?" doc
... remaining mechanisms Trauma severity was evaluated according to Injury Severity Score (ISS) and organ injury according to Injury Scaling and Scoring System [9] Patients' status in admission was ... The rationale was that transient tachycardia or hypotension could occur from a non-abdominal origin (e.g extraabdominal trauma, medication, inadequate volume replacement) or from an ongoing, ... and design, acquisition, analysis and interpretation of data; performed statistical analysis; revision of the manuscript NET was involved in acquisition of data and drafting the manuscript PAP...
Ngày tải lên: 13/08/2014, 23:20
Trade and Poverty Is There a Connection
... on inputs into Bangladeshi agriculture and show how their relaxation greatly increased the availability of, for example, small tractors and water pumps to small farmers Not only are prices affected ... vocal about) declines in welfare than on equal increases, and it is easy to see how attitudes towards liberalization policy are biased towards antipathy Moreover it is usually the case that the ... agro-processing, particularly within the maize sub-sector For example, in Zimbabwe 3,500 new hammer mills have opened up since liberalization, mainly in the rural areas, and the share of hammer millers in...
Ngày tải lên: 06/11/2012, 15:51
BitLocker: Is It Really Secure?
... Page • Forgetting the PIN when PIN authentication has been enabled • Losing the USB flash drive containing the startup key when startup key authentication has been enabled An administrator can ... this scenario, the administrator sets up a numeric PIN during BitLocker initialization BitLocker hashes the PIN using SHA-256 and the first 160 bits of the hash are used as authorization data sent ... Upgrades Disabling BitLocker Protection An administrator may want to temporarily disable BitLocker in certain scenarios, such as: • Restarting the computer for maintenance without requiring user input...
Ngày tải lên: 16/10/2013, 12:15
Service-Oriented Architecture: What Is It and How Can It Help Your Business?
... database in different manners Trainers, for example, could be given access to a thick client application that enables them to search a complete database, including courses that are not made available ... Arlington Group, as well as a principal of AEC software To learn more about information technology training, please visit http://www.westlaketraining.com Copyright ©2007 Global Knowledge Training ... particular topics And sales people could be given even a different way to access that database to find out not only when courses are available but in which locations, leading to weather information and...
Ngày tải lên: 16/10/2013, 12:15