... proposals and findings Development of consumer satisfaction indicators & Pilot survey 1.3.2 Clarification of objectives and requirements During the early stages of the assignment, the objectives and ... Analysis and reporting: standard and model-based The finalisation of the methodology and the preparation of this final report were carried out in the period September–November 2004 Development of consumer ... for the construction of consumer satisfaction indicators In section 2.2 we introduce and define a number of terms and concepts This is important in view of the interpretation of the results, since...
Ngày tải lên: 23/10/2012, 11:54
... CARAT – Control of Allergic Rhinitis and Asthma Test This is a translation to English of the of the preliminary version of Control of Allergic Rhinitis and Asthma Test, the development of which is ... Description of the use of a web application in the consensus process for the development of the Control of Allergic Rhinitis and Asthma Test (CARAT) The data provide more details on the development and ... rhinitis and asthma (ARA) are inflammatory diseases and are often associated The lack of control of these diseases is responsible for a significant loss in patient's quality of life and an important...
Ngày tải lên: 12/08/2014, 14:20
Design and development of major balance of plant components in solid oxide fuel cell system
... any SOFC system, the performance of the INER SOFC system is dependent not only on the design and operating conditions of the fuel cell stack, but also on the design and operating conditions of ... provided by the anode off-gas given an anode off-gas temperature of less than 650 oC, a cathode off-gas temperature of less than 390 oC, and a flame barrier temperature of less than 700 oC However, ... SOFC BOP system (S/C=1.7, O/C=0.3, fuel utilization = 64.2%, electrical conversion efficiency = 44%) Design of SOFC BOP components The BOP components of a SOFC system account for between 50% and...
Ngày tải lên: 05/09/2013, 16:10
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... between yeast and mammalian GPCR signaling pathways, this assay enables the quantitative measurement of receptor activity, or alternately the detection of its ligands Using known ligands of I7 OR ... related ligands strongly suggests the authenticity of its ligand binding and the maintenance of the coding ability at the receptor level Consequently this suggests that glycosylation of I7 OR is ... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40...
Ngày tải lên: 07/03/2014, 16:20
THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT pptx
... AND DEVELOPMENT OF THE CEREAL PLANT 24 THE WHEAT BOOK THE WHEAT BOOK CHAPTER – THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT Tim Setter and ... formation of florets within each spikelet and, later, the regression and death of some florets and spikelets and the death of some tillers This phase is also the time of greatest dry mass increase and ... Mainstem and tillers 26: Mainstem and tillers 27: Mainstem and tillers 28: Mainstem and tillers 29: Mainstem and or more tillers Dough development Kernel no longer watery but still soft and dough-like...
Ngày tải lên: 08/03/2014, 23:20
history and development of higher education in india 1 5 ppt
Ngày tải lên: 09/03/2014, 17:20
Concepts and measures of reproductive morbidity* pptx
... medical professionals to a better understanding of how their educational system, as well as the interests and power of their profession, shape them as human beings and limit the focus of their professional ... of the disciplines of social and health sciences from each other, and to improve communication and collaboration in understanding and improving living and health conditions of women in our region ... understanding by all professionals of the interaction of the social and health conditions of women Education and training programs The second policy avenue we considered deals with the preparation and...
Ngày tải lên: 14/03/2014, 16:20
Origin and Development of Commercial and Islamic Banking Operations pot
... BC) of Lydia They were of electrum Origin and Development of Commercial and Islamic Banking Operations (a mixture of gold and silver) This must have encouraged the emergence and practices of banking ... ups and downs depending on the political and military conditions of the Republic In time of wars and disorder, inflation, financial stagnation and bankruptcy prevail and in times of peace and ... Bin Salih and above all two Jewish merchants and bankers: Yusuf Bin Finkhas and Harun Bin Imran of Baghdad who were appointed to the office of jahbadh of the Persian province Ahwaz and later...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... conjugation of the quencher and the fluorophore influenced neither the rate nor the site of hydrolysis of the peptide Sensitivity and selectivity of the Dabcyl– EVYAVES–Edans substrate and the activity of ... the development of such a substrate based on analysis of PrtA cleavage site specificity, and kinetic characterization of PrtA activity on the new substrate Results and Discussion Identification of ... samples For an exploration of the proteolytic system of PrtA, and an understanding of its role in the infection process of Photorhabdus, we needed a highly sensitive and specific substrate to selectively...
Ngày tải lên: 23/03/2014, 09:20
ORIGIN AND DEVELOPMENT OF FORM AND ORNAMENT IN CERAMIC ART pptx
... painted upon pottery 463 488.—Theoretical development of fret work 464 489.—Theoretical development of scroll work 465 [Pg 443] ORIGIN AND DEVELOPMENT OF FORM AND ORNAMENT IN CERAMIC ART By William ... the shape of the vessels employed at the time of the introduction of the art, and these depend, to a great extent, upon the kind and grade of culture of the people acquiring the art and upon the ... with the use of clay and a capacity in handling it that, with advancing culture, brought all nature within the reach of the potter and made it assist in the processes of variation and development...
Ngày tải lên: 28/03/2014, 20:20
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx
... DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical ... responsibility for the use of these circuits and/ or software or of systems incorporating these circuits and/ or software lies with the reader, who must apply for any and all approvals and certifications ... provide an assortment of desired passband and gain characteristics selection and preparation of electrode placement on the subject, and by keeping the bandpass characteristics of the biopotential...
Ngày tải lên: 29/03/2014, 11:20
plasma nanoscience. basic concepts and applications of deterministic nanofabrication, 2008, p.565
... practical performance of numerous plasma-based nanofabrication facilities and in-depth understanding of fundamental properties and operation principles of such devices and tools and elementary processes ... active and productive research in the area, my colleagues and myself realized that the capabilities of “trial and error” approaches will soon be exhausted and deterministic “cause and effect” approaches ... is a vital demand for the development and wider practical use of sophisticated, and yet simple, deterministic “cause and effect” approaches It is important to mention that such approaches would...
Ngày tải lên: 04/06/2014, 14:49
Báo cáo hóa học: " On the understanding and development of modern physical neurorehabilitation methods: robotics and non-invasive brain stimulation" pdf
... optimally promote development and retention of motor skills and translate into long-term reduction in disability Also supporting a quantitative scientific understanding of mechanisms of post-stroke ... extend beyond orthopaedic, and impact recovery of motor control, we know that therapies cannot be passive and patients must be engaged Perhaps part of the 'magic' in the hands of the individual therapist ... disorders, and discusses current NBS plasticity protocols applied in clinical research Understanding stroke recovery This thematic series emphasizes the understanding and development of modern...
Ngày tải lên: 19/06/2014, 08:20
Opal''''s Site Organization and Development of Russian Business_1 docx
... and nonmembers of business associations Indicators of financial standing of joint-stock companies and membership in business associations Types of support rendered to authorities and aid through ... analysis of probability to obtain financial and organizational support from the state authorities Utility of business associations and their contribution to the establishment of standards and rules of ... impacts of business integration via the formation of holding companies and other types of business groups upon corporate governance and firm performance of affiliated firms; and (c) the role and...
Ngày tải lên: 20/06/2014, 20:20
Opal''''s Site Organization and Development of Russian Business_2 pptx
... by studies of economic transition and company behavior in transition economies, with the participation of leading economists of the world, including Andrei Shleifer, Gerard Roland, and Josef Stiglitz ... were related to the compilation and approval of five-year plans and implementation of investment projects came within the competence of higher levels of government); and (c) managers were involved ... planned target volumes and resources allocated to the enterprise and with suppliers and customers on product mix and other terms of supply This pattern of behavior was typical of enterprises in all...
Ngày tải lên: 20/06/2014, 20:20
Opal''''s Site Organization and Development of Russian Business_3 pdf
... Organization and Development of Russian Business Less than 25% of shares 13% More than 50% of shares + absence of a counterbalance 48% From 25% to 50% of shares 18% More than 50% of shares + presence of ... in lack of capacity, lower wages and profitability, and a higher risk of loss Moreover, the authors produced evidence (in a small sample of companies) of the positive role of the size of shareholding ... loans, and funds of Russian partners and other private investors A comparison of ownership structures and intensity of corporate restructuring performed by the Bureau of Economic Analysis as part of...
Ngày tải lên: 20/06/2014, 20:20
Opal''''s Site Organization and Development of Russian Business_4 ppt
... free of charge and the shares of state-owned and municipal enterprises On the other hand, in consideration of the fact that managers are still the dominant shareholders in many Russian firms and ... part of the new managers may also contribute This mechanism of control is well studied: a series of works were dedicated to the analysis of change of managers, especially due to ineffectiveness of ... issue pertains to the efficiency and quality of self-management from the point of view of a company’s development, in which case market mechanisms for the selection of skilled managers fail to work...
Ngày tải lên: 20/06/2014, 20:20
Opal''''s Site Organization and Development of Russian Business_5 potx
... effect of state involvement is much stronger than the influence of private owners The impact of capital demand and the development of local financial institutions also reduce the probability of the ... (1983a) Separation and ownership and control, Journal of Law and Economics, 26: 301–326 Fama, E F & Jensen, M C (1983b) Agency problems and residual claims, Journal of Law and Economics, 26: ... in terms of the accuracy and transparency of disclosed company information because of the failure to enforce the IAS at all enterprises as well as because of the insufficient number of auditing...
Ngày tải lên: 20/06/2014, 20:20
Opal''''s Site Organization and Development of Russian Business_6 pptx
... governance and the board of directors: Performance effects of changes in board composition, Journal of Law and Economics, 1: 101–124 Baysinger, B & Hoskisson, R E (1990) The composition of boards of ... performance of their managers on the basis of the quality of their decisions rather than on the basis of financial results specific to the business they manage because of its technical uncertainty and ... rivals and other companies in the same trade has an impact on its dismissal of insider directors and its appointment of their successors from the outside regardless of differences in period and...
Ngày tải lên: 20/06/2014, 20:20