applications of a natural polymer in regenerative medicine
Potential applications of chitosan based hydrogels in regenerative medicine
Ngày tải lên :
10/09/2015, 09:23
... in PBS) in a 15 ml tube maintained at 37ºC 21 in a water bath shaker operating at 100 rpm The degradation solution was refreshed daily to maintain the activity of the lysozyme and the test was ... Chitosan as growth factor carrier for bone and wound healing Chitosan is a linear polysaccharide of glucosamine and N-acetyl glucosamine obtained from deacetylation of chitin, the second most abundant ... effects In Chapter 6, CMCS scaffolds with and without mineral trioxide aggregate (MTA) coating was investigated for possible application as patches for stimulating dentin remineralization in tooth affected...
- 131
- 649
- 0
APPLICATIONS OF MONTE CARLO METHODS IN BIOLOGY, MEDICINE AND OTHER FIELDS OF SCIENCE pps
Ngày tải lên :
29/06/2014, 13:20
... Kinase, Akram Mohammadi and Masa Takahashi Chapter Applications of Monte Carlo Simulation in Modelling of Biochemical Processes 57 Kiril Ivanov Tenekedjiev, Natalia Danailova Nikolova and Krasimir ... methods in many fields of human endeavor In an attempt to focus attention on a manageable set of applications, the main thrust of this book is to emphasize applications of Monte Carlo simulation ... development of techniques for genetically engineering small animals has increased interest in vivo imaging of small animals The contents of chapter 11 are a paper by S Branco et al on using Monte Carlo...
- 438
- 571
- 0
Chapter 067. Applications of Stem Cell Biology in Clinical Medicine (Part 1) ppt
Ngày tải lên :
07/07/2014, 01:20
... proliferation of inappropriate cell types, ensuring the viability and function of the engrafted cells, overcoming immune rejection when autografts are not used, and facilitating revascularization of the ... treatment of the brain), and somatic stem cells capable of generating cell types specific for the target rather than the donor organ (e.g., bone marrow mesenchymal stem cells for cardiac repair) ... human ES cells has been controversial, and their use in clinical applications would be unacceptable to some patients and physicians despite their enormous potential Somatic cell nuclear transfer...
- 5
- 456
- 0
Chapter 067. Applications of Stem Cell Biology in Clinical Medicine (Part 2) pps
Ngày tải lên :
07/07/2014, 01:20
... have employed intramyocardial, transendocardial, intravenous, and intracoronary injections In experimental myocardial infarction, functional improvements have been achieved after transplantation ... as a terminally differentiated organ without the capacity for regeneration However, the heart has the ability to achieve low levels of cardiomyocyte regeneration as well as revascularization This ... transplantation into patients with diabetes, whereas cardiomyocytes could be generated to treat ischemic heart disease; and (3) stimulation of endogenous stem cells to facilitate repair—e.g., administration...
- 5
- 316
- 0
Chapter 067. Applications of Stem Cell Biology in Clinical Medicine (Part 3) pot
Ngày tải lên :
07/07/2014, 01:20
... abortuses are an alternative, and a clinical trial of fetal neural stem cells in Batten disease is commencing Transdifferentiation of bone marrow and adipose stem cells into neural stem cells, and ... Multipotential stem cells also reside within gastric glands and intestinal crypts Thus, hepatic, pancreatic, and/or gastrointestinal precursor cells may be candidates for cell-based therapy of diabetes ... the pancreas, liver, and gastrointestinal tract are all derived from the anterior endoderm, and transdifferentiation of the pancreas to liver and vice versa has been observed in certain pathologic...
- 5
- 365
- 0
Chapter 067. Applications of Stem Cell Biology in Clinical Medicine (Part 4) pot
Ngày tải lên :
07/07/2014, 01:20
... extraordinary, and disorders such as myocardial infarction, diabetes, Parkinson's disease and many others are attractive targets However, such stem cell–based therapies are at a very early stage ... coadministration of scaffolding, artificial extracellular matrix, and/or growth factors to orchestrate differentiation of stem cells and their organization into appropriate constituents of the ... their therapeutic applications in regenerative medicine and cancer therapies Clin Pharmacol Ther 82(3):252, 2007 [PMID: 17671448] National Institutes of Health: Stem cell information page URL:...
- 5
- 311
- 0
Applications of prolyl hydroxylase inhibitors in tissue engineering and regenerative medicine
Ngày tải lên :
09/09/2015, 11:11
... Chapter Incorporation of a PHI into Scaffolds: A Vascularization Strategy for Tissue Engineering Applications 33 3.1 Introduction As explained in chapter 1, inadequate vascularization is a major ... PHI-delivering scaffolds as a strategy for improving vascularization in tissue engineering applications As a proof -of- concept, we incorporated PDCA, a known PHI [43, 69], into a gelatin sponge test scaffold ... xv Chapter Introduction 1.1 Background 1.1.1 Regenerative medicine – a new paradigm in healthcare Advances in healthcare and hygiene have dramatically increased life expectancy in the past century,...
- 142
- 261
- 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
Ngày tải lên :
20/06/2014, 00:20
... strain on the bursa subacromialis and so in a typical case of "painful arc" the movement would cause less pain The most reliable test of internal and external rotation is carried out with the arms ... involves asking the patient to place his hands behind his back (in Table 2: Differential diagnosis of lumbar spine disorders Lumbar pain Lumbago Sciatica Radicular syndrome disorders affecting spinal ... Testing for cranial movement of the spinae iliacae posteriTesting for cranial movement of the spinae iliacae posteriores superiores supine This part of the functional diagnostic examination begins...
- 10
- 575
- 0
Báo cáo lâm nghiệp: "Conversion of a natural broad-leafed evergreen forest into pure plantation forests in a subtropical area: Effects on carbon storage" pps
Ngày tải lên :
08/08/2014, 00:22
... forest of Castanopsis kawakamii, and an adjacent relict natural forest of Castanopsis kawakamii (NF) that as a control, provided a unique opportunity to examine how changes occur following converting ... (85% of total stand basal area for C kawakamii), old age (~ 150 year), and large area (~ 700 ha) In addition to C kawakamii, the overstorey also contained other tree species, such as Pinus massoniana, ... Symplocos caudate, Machilus velatina, Randia cochinchinensis and Symplocos stellaris) in the NF, 12 of C kawakamii in the CK, 11 of O xylocarpa in the OX, 12 of F hodginsii in the FH, and 12 of Chinese...
- 10
- 384
- 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
Ngày tải lên :
05/09/2013, 14:59
... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... parameters defined in Tables and in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy project located ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attractiveness Table Economic and financial indicators...
- 14
- 416
- 1
Sensor-based navigation of a mobile robot in an indoor environment
Ngày tải lên :
23/10/2013, 15:15
... obtained after including the unknown obstacle in the data base and starting again the planning [15] In fact the main penalization due to unknown obstacles is the decreasing of the linear speed of ... We are interested in the navigation of a mobile robot in partially known environment such as inside an of ce or a flat In such cases, a plan of the evolution zone of the robot containing most of ... the beginning of the learning the robot is near a wall in an unknown Vr = min(Va , Cvg Vmin ), where Vmax and Vmin are the maximum and minimum chosen linear speed, respectively An example of implementation...
- 18
- 431
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
Ngày tải lên :
22/02/2014, 04:20
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the above interpretation was further reinforced...
- 6
- 488
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
Ngày tải lên :
08/03/2014, 09:20
... transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial strains and plasmids ... immunoprecipitated with antiserum directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig 4B, lane 1) In addition, cross-linking adducts of 220 kDa and ... immunoprecipitated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager (B) Quantification of data presented in panel (A) , after correction for translation...
- 8
- 546
- 0
The Project Gutenberg EBook of A First Book in Algebra, pot
Ngày tải lên :
15/03/2014, 00:20
... subtracted from − 4a to obtain a? (− 4a) − (− 3a) =? Examine now these results expressed in another form 33 From take 5a 3a 2a To add 5a − 3a 2a From take 4a 7a − 3a To add 4a − 7a − 3a From take 2a 5a ... 2ax2 + ax + 2a 17 A man pumps x gallons of water into a tank each day, and draws off y gallons each day How much water will remain in the tank at the end of five days? 18 Two men are 150 miles apart, ... 2a, 3a, 4a, 5a What must be added to 2a to obtain 5a? What then must be subtracted from 5a to obtain 2a? 5a − 3a =? What must be added to − 3a to obtain 4a? What then must be subtracted from 4a to...
- 189
- 432
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
Ngày tải lên :
15/03/2014, 00:20
... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra ... the following oligonucleotide primers: 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast expression ... thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were in ltrated into the same leaves of tobacco plants, which had been sprayed with 100 lm ABA, 400 lm ABA or H2O and kept in...
- 15
- 479
- 0
effects of dimensions on the sensitivity of a conducting polymer microwire sensor
Ngày tải lên :
19/03/2014, 16:48
... Film Based on the method of least square [27], a statistical program SAS has been run to fit the data points for further analyzing the sensing results and examining the effects of each individual ... sensing material used in the sensor In addition to this, as indicated in [8], the way to make the film may also affect the sensitivity of a sensor Manufacturing approaches affected the surface ... increasing surface-to-volume ratios at various concentrations of the methanol and acetone vapors The sensitivity data obtained from experiments were analyzed with the aid of a statistical program,...
- 9
- 547
- 0
Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt
Ngày tải lên :
23/03/2014, 10:21
... replacement of a Pro with an Ala maintained or decreased the antimicrobial activity but significantly increased the hemolytic activity In addition, Oh et al [38] reported that a cecropin A magainin ... antimicrobial activity The antimicrobial activity of peptides against a range of micro-organisms was determined by broth microdilution assay Briefly, a single colony of bacteria was inoculated into ... other Central proline in amphipathic a- helix amphipathic a- helical peptides such as magainin [52,53], the initial binding of M17P (K1 ¼ 6.8 · 104 m)1) was much faster than the following insertion...
- 15
- 376
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
Ngày tải lên :
28/03/2014, 23:20
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A 78 A1 K UG a ... UG na B C1 thalia T89 UG 9B1 A UGT8 9A1 P A thaliana M T7 UG 0.1 UGT8 a lian tha C UGT9 2A1 A thaliana A rum rba ba UGT90 A1 A th aliana UGT 73D1 A tha UG liana T 0L na lia A t D 73C 1 3B 3A T7...
- 11
- 661
- 0