appendix a a 3 cgi and the www server
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt
... House (Bath, UK) produces the Society's international journals and books, and acts as European distributor for selected publications of the American Association of Petroleum Geologists (AAPG), the ... Indonesian Petroleum Association (IPA), the Geological Society of America (GSA), the Society for Sedimentary Geology (SEPM) and the Geologists' Association (GA) Joint marketing agreements ensure that ... 9000 The Society has the power to confer Chartered status on suitably qualified Fellows, and about 2000 of the Fellowship carry the title (CGeol) Chartered Geologists may also obtain the equivalent...
Ngày tải lên: 06/07/2014, 08:20
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... Average ligand B-factor (A2 ) BGC2b ˚ Average ligand B-factor (A2 ) L3-1c ˚ Average ligand B-factor (A2 ) L3-2d ˚ Average ligand B-factor (A2 ) Ca ˚ Average water B-factor (A2 ) Protein Data Bank entry ... volume (A3 ) Number of protein atoms Number of ligand atoms Number of water atoms ˚ Average main chain B-factor (A2 ) ˚ Average side chain B-factor (A2 ) ˚ Average ligand B-factor (A2 ) BGC 1a ˚ Average ... GGT -3 ; E292S: 5¢-GG AAC GTC GCT GGT TCA TGG TCT GCT GCT TTG -3 Outside primers (also used for DNA sequencing) were T3: 5¢-ATT AAC CCT CAC TAA AG -3 and T7: 5¢-AAT ACG ACT CAC TAT AG -3 Expand...
Ngày tải lên: 15/03/2014, 23:20
Tài liệu Appendix A. Getting and Building the Mozilla Source doc
... environment variables Table A- 2 lists these variables and expected values Note that some values are optional Table A- 2 Windows environment variables used to build Mozilla Variable Value Descripti ... the necessary arguments: > nmake -f client.mak build_all Table A- 3 lists these arguments and what they Leaving out this compile flag starts an incremental build or a fresh build if there is no ... available When building incrementally, try to use the provided make script instead of the cvs checkout and build_all commands The latter command can lead to inconsistencies in file versions and...
Ngày tải lên: 26/01/2014, 07:20
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC -3 ; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... cytoskeleton and translational apparatus J Cell Sci 111, 1 83 197 12 Szabo, A. , Dalmau, J., Manley, G et al (1992) HuD, a paraneoplastic encephalomyelitis antigen, contains RNA-binding domains and is ... 17, 34 61 34 70 53 Dean, J.L.E., Wait, R., Mahtani, K.R., Sully, G., Clark, A. R & Saklatvala, J (2001) The 3 untranslated region of Tumor Necrosis Factor alpha mRNA is a target of the mRNA-stabilizing...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... monoclonal antibodies against Tyr-tubulin (Tub 1A2 ) and total a- tubulin (DM 1A) , peroxidase-conjugated rabbit antimouse IgG, rhodamineconjugated goat antirabbit, and fluorescein-conjugated goat antimouse ... a- tubulin and cellular dysfunction 10 11 12 13 14 15 ACKNOWLEDGEMENTS 16 We thank Drs Carlos E Argarana and Mario Guido for critical ˜ reading of the manuscript, Mrs S N Deza and Mrs M G Schachner ... dividing the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody Capabilities of nitrotyrosinated and...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
... (F) 4.66 3. 32 3. 50 3. 40 3. 43 4.08 3. 96 3. 93 3. 83 Polymer III 3. 90 3. 72 * or 2); CH3CON, d1. 93 and 2.07 chromatography [25] The absolute configuration of ManpNAc3NAcA(D-) in the polymer I was inferred ... (glucose) and the 4-substituted ManpNAc3NAcA residue [26,27] The signals for a- D-Glcp and b-D-ManpNAc3NAcA were identified in the 1H COSY and TOCSY spectra The anomeric configuration of the Glcp ... H-5 3. 36 3. 58 4.40 4 .33 3. 40 3. 69 3. 93 4. 03 3.98 3. 88 3. 95 3. 55 4.01 3. 80 3. 66 H-5¢ H-6 H-6¢ H-7 H-8 H-9 H-9¢ Polymer II (C) 1.78 2.20 (D) 4.55 3. 31 3. 50 3. 38 3. 39 (E) 4.09 3. 97 3. 96 3. 81 4.18...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx
... membrane fractions with anti-PCaP1 Lanes and 6, A thaliana; lanes and 7, Raphanus sativus; lanes and 8, Brassica rapa; lanes and 9, B rapa var glabra; lanes and 10, B oleracea var italica The amount ... plants [Raphanus sativus (radish), Brassica rapa (turnip), Brassica rapa L var glabra Regel (Chinese cabbage) and Brassica oleracea var italica (broccoli)] were purchased from a market Purification ... of protein applied was lg for A thaliana and 40 lg for the other plants 43 kDa) and Brassica oleracea var italica (broccoli, 41 kDa) (Fig 1B) The immunostained bands disappeared when the corresponding...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx
... M Tanaka Relaxin -3 expression and function in the hypothalamus that relaxin -3 is abundant in the brain, but not in female reproductive tissue such as the ovary and uterus [1,6] By contrast, the ... the area dorsal to the substantia nigra in the midbrain reticular formation By immunostaining using monoclonal antibody against the N-terminus of the human relaxin -3 A- chain [2], relaxin -3- immunoreactive ... olfactory bulb, paraventricular nucleus (PVN) and supraoptic nucleus (SON) in the hypothalamus amygdaloid–hippocampal area, as well as the bed nucleus stria terminalis, paraventricular thalamus, superior...
Ngày tải lên: 29/03/2014, 21:20
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx
... McGee MA, Jagger CA: Health and illhealth in the older population in England and Wales The Medical Research Council Cognitive Function and Ageing Study (MRC CFAS) Age Ageing 2001, 30 : 53- 62 Thomas ... restriction at baseline to any restriction at three year follow-up) and three-year persistence (any restriction at both baseline and follow-up) were calculated overall, and by age and gender, and summarized ... restriction (examining onset and persistence separately), within strata defined by age, gender, educational attainment, occupational class and general health (using SF-12 physical and mental health scores),...
Ngày tải lên: 18/06/2014, 19:20
Muller A History of Thermodynamics The Doctrine of Energy and Entropy phần 3 doc
... dV dV dt Fig 3. 7 (p,V)-diagram of an infinitesimally small Carnot cycle in a gas The work was calculated as the area of the parallelogram By the first law the heat exchanged equals the work done: ... the first and second laws for what they are: Balance equations, or conservation laws on a par formally with the balance equations of mass and momentum dV in a Generically an equation of balance ... is therefore considerably reduced, and that is a direct result of the Gibbs equation and the second law Insert 3. 6 Once we know the thermal and caloric equations of state we may calculate the...
Ngày tải lên: 23/07/2014, 16:21
Báo cáo y học: "Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium" docx
... forward 5'-GTGAACGCCGTGCACTGGTTCCGAAAGGGAC -3' , mCry1 reverse 5'GTCATGATGGCGTCAATCCACGGGAAGCCTG -3' ; mPer2 forward 5'-GATCAGCTGCCTGGACAGTGTCATCAGGTACC -3' , and mPer2 reverse 5'-CTGAGCGTCGAGGTCCGACTAGGGAACTCAGCC -3' ... 5'-CAGCTTCCAGTCCCTGACTCAAGGTTGTCCCACATAC -3' , RevErbα reverse 5'-GGCGTAGACCATTCAGCGCTTCATTATGACGCTGAG -3' ; Bmal1 forward 5'-CCGTGCTAAGGATGGCTGTTCAGCACATG3', Bmal1 reverse 5'-GTCCTCTTTGGGCCACCTTCTCCAGAGGG -3' ; ... McNamara P, Naik KA, FitzGerald GA, Kay SA, Hogenesch JB: A functional genomics strategy reveals Rora as a component of the mammalian circadian clock Neuron 2004, 43( 4):527- 537 Iitaka C, Miyazaki...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: " Dietary intake of fish, omega-3, omega-6 polyunsaturated fatty acids and vitamin D and the prevalence of psychotic-like symptoms in a cohort of 33 000 women from the general population" ppt
... intake and dietary intake of vitamin B12, alcohol and dietary intake of other than omega-6 fatty acids g Sum of eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), docosapentaenoic acid and ... omega -3 fatty acids, we summarized the intake of α-linolenic, EPA, DHA and docosapentaenoic acids (DPA) We combined EPA, DHA and DPA to estimate the total intake of marine fatty acids To estimate ... idea in collaboration with MH MH processed all food diaries and calculated intake of energy and nutrients, prepared a database with all variables as well as performed the data analyses, in collaboration...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "Combined adenocarcinoid and mucinous cystadenoma of the appendix: a case report" pdf
... 34 :33 8 -34 4 Kanthan R, Saxena A, Kanthan SC: Goblet cell carcinoids of the appendix: immunophenotype and ultrastructural study Arch Path Lab Med 2001, 125 :38 6 -39 0 Staley CA: Primary appendiceal malignancies ... presentation is 59 years and the 5-year survival rate ranges from 60% to 84% [8] The tumour usually spares the mucosa, infiltrates muscularis propria and peri-appendiceal fat and can stain positively ... showing appendix mucocele Adenocarcinoids account for 2% of primary appendiceal malignancies Most tumours are less than cm in diameter and 20% of them metastasize to the ovaries [7] The mean age at...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf
... method and the RT-PCR were performed as described elsewhere [36 ] The IFR -3 cDNA was PCR amplified using forward 5'-CATGAATTCATGGGAACCCCAAAGCCA -3' and backward 5'-TGACTCGAGTCAGCTCTCCCCAGGGCC -3' primers ... right panel) (see also [29]) Conversely, NTAIL S407C -XD +XD +IRF3 NTAIL L496C NTAIL V517C 34 7 34 8 34 9 35 0 35 1 35 2 35 3 35 4 35 5 35 6 34 7 34 8 34 9 35 0 35 1 35 2 35 3 35 4 35 5 35 6 B (mT) B (mT) Analysis ... –His-Ura-Trp + X-Gal PCT (B) AD-IRF3 (65 kDa) AD-PCT (58 kDa) IRF3 83 kDa 62 kDa 47.5 kDa Analysis IRF -3 and NTAIL interaction in yeast Figure of Analysis of IRF -3 and NTAIL interaction in yeast (A) ...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "The incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter stud" pptx
... Orthopaedics and Traumatology I, San Giovanni Addolarata Britannico Hospital, Via dell’Amba Aradam 9, Rome, 00184, Italy 6Division of Orthogeriatrics, San Camillo Hospital, Piazza Carlo Forlanini ... gender and age group According to the analyses performed on the National Hospitalizations Database, the overall number of hip and other “minor” fragility fractures occurring each year in Italy has ... vertebral fractures in our survey and data from the National Hospitalization Database (SDO) To acquire all the necessary data concerning hospitalizations, the SDO archive was enquired for the following...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: "Scoliosis treatment using spinal manipulation and the Pettibon Weighting System™: a summary of 3 atypical presentations" pptx
... History and examination A 23- year-old female presented with bilateral diffuse neck and lumbodorsal pain, and right-sided scapular and shoulder pain The pain was constant and sharp in nature with radicular ... dorsi, the left trapezius, the left quadratus lumborum, and the left rhomboid muscles Standing anteroposterior and lateral cervical and lumbar radiographs were obtained and analyzed for regional alignment ... numerical pain rating scale, rated a 7.0/10 at the onset of care, dropped to a 0/10 The average numerical pain rating scale score over the 8-week span was 3. 3 out of 10 On the post-treatment anteroposterior...
Ngày tải lên: 13/08/2014, 14:20
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 3
... decades 9 .3. 4 Land use performance and visual privacy The assessment of visual privacy performance bases on the distance of available point that horizontal and downward views are available of the ... hard-paved area of the site (P) should be kept as low as possible, and the total net usable area of the building (Anet) should be as large as possible In Singapore, scarcity of land has always ... overcome the obstacle and can gain high land use performance, if large greenery area is provided 195 9 .3 9 .3. 1 Land use performance and its interconnectedness Land use performance and change in...
Ngày tải lên: 16/09/2015, 08:29
Cambridge.University.Press.War.and.the.Law.of.Nations.A.General.History.Sep.2005.pdf
... steppe-lands between agricultural and nomadic ways of life, a conflict as ancient (in mythology at least) as the clash between Cain and Abel and as recent as (comparatively) the day before yesterday.1 ... point about them is the way in which they indicated that war-making was a methodical and painstaking affair, a far cry from a mere blind lashing out at enemies .34 Yet another way in which rational ... accounts and analyses, see Wiedemann, ‘Fetiales’; and Watson, International Law 28 WAR AND THE LAW OF NATIONS code of warfare’.57 One point that may be noted about the Roman practice was that...
Ngày tải lên: 21/09/2012, 11:02