... NFκB κ MIAPaCa Figure 11 Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell lines Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell ... proliferation and antiapoptotic and metastatic gene products through suppression of IkappaBalpha kinase and Akt activation Mol Pharmacol 2006, 69:195-206 Hidaka H, Ishiko T, Furuhashi T, Kamohara H, ... 5-fluorouracil derivative to brain tissue through intravenous route using surface modified nanogels J Drug Target 2006, 14:87-95 Tyagi R, Lala S, Verma AK, Nandy AK, Mahato SB, Maitra A, Basu MK: Targeted...
Ngày tải lên: 11/08/2014, 00:22
... of ATP hydrolysis, usually by ATPases of the AAA or AAA+ superfamily (ATPases associated with various cellular activities) (Neuwald et al., 1999) These ATPase chaperones or chaperonins unfold and ... trans-translation, in which an alanyl-tmRNA enters the empty A site of the ribosome causing the release of the truncated mRNA lacking a STOP codon The SsrA RNA also adds 11 amino acid tag (AANDENYALAA) ... the same group demonstrated that mpa and pafA mutants are severely attenuated in a mouse model of infection (Darwin et al., 2005) Mpa is an ATPase that forms hexamers like the Clp ATPase Meanwhile,...
Ngày tải lên: 26/11/2015, 22:38
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... Journal compilation ª 2008 FEBS No claim to original German government works 743 A novel route for geranial formation A Ilg et al to the peak area of the internal standard, which was quantified at ... Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 189–194 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu 15 17 18 ... medium for 30 For HPLC analyses, cells were harvested after h, and carotenoids were extracted and processed as described above Analytical methods For HPLC analyses, a Waters system equipped with a...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba docx
... treatment for (a) and 60 (b) with alkaline phosphase (Merck, Darmstadt, Germany; 100 U) at 37°C, as analyzed by HPLC Influence of ginkgotoxin on human pyridoxal kinase This material is available as part ... PKH leads inter alia to a decreased availability of PLP for GAD, which catalyses the formation of c-aminobutyric acid, the most potent inhibitory neurotransmitter in the mammalian brain Decreased ... membrane-bound phosphatases (Fig 2A) [13,14] Inside the brain a rephosphorylation to PLP takes place, again catalysed by pyridoxal kinase (Fig 2A) [7,14] As a consequence, there is a requirement for...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt
... In all structures of canonical ACs, i.e mammalian AC, trypanosomal AC and mycobacterial AC Rv1264 the lysine-aspartate couple forms a salt bridge [5,7,26] Even in Rv1900c the asparagine-aspartate ... of the available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor they parallel the findings on the noncanonical class IIIc AC Rv1900c ... because the canonical amino acids which define substrate specificity are replaced in a nonconservative manner, glutamine-asparagine instead of lysine-aspartate All mammalian membrane-bound ACs...
Ngày tải lên: 07/03/2014, 21:20
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and ... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in vitro ... Multani AS, Ozen M, Narayan S, Kumar V, Chandra J, McConkey DJ, Newman RA and Pathak S: Caspase-dependent apoptosis induced by telomere cleavage and TRF2 loss Neoplasia 2: 339-345, 2000 12 Pathak...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... pcDNA3.1-GST-Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... CCTCCAAAAAGCACACAGA-3¢ for St-182 and St-93/ -182, 5¢-AGAAATTATCATCTTTTCCAGTCCGAGA-3¢ for St-93 and St-93/-182, and 5¢-TGGTCTTGAACTCCT CGTGATCTGCCCA-3¢ for Lst-595 pcDNA3.1-Nur77 expression plasmid ... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢ Another...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); epidermal ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... scDNA (B) Ethidium stained agarose gel: lane 1, scDNA only; lane 2, no mAb; lanes 3–6, Bp53-10.1; lanes 7–10, ICA-9 mAb/p53 tetramer molar ratios: lanes and 7, 0.5; lanes and 8, 1.25; lanes and ... by ionizing radiation Proc Natl Acad Sci USA 92, 9455 9459 17 Fojta, M., Pivonkova, H., Brazdova, M., Kovarova, L., Palecek, E., Pospisilova, S., Vojtesek, B., Kasparkova, J & Brabec, V (2003) ... supernatants or ascites by means of affinity chromatography using either protein G-Sepharose (Pharmacia) or protein L-Sepharose (Pierce) horseradish peroxidase conjugated anti-rabbit IgG (Sigma)...
Ngày tải lên: 30/03/2014, 15:20
a novel method for the synthesis of titania nanotubes using
... Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 363 466 0A) After an initial increase-decrease transient, the current reached a steady-state value The anodized samples were properly washed ... crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical method and annealed ... in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated N2 -UAT and O2 -UAT The TiO2 nanotubes...
Ngày tải lên: 05/05/2014, 15:26
a novel method for the synthesis of cao nanoparticle
... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent ... high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner ... (PVP) surface as a solid phase condensation[21], laser ablation[21], catalyst due to good catalytic properties and M Sadeghi et al., J Appl Chem Res., 7, 4, 39-49 (2013) 41 high performance for the...
Ngày tải lên: 06/05/2014, 08:55
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... data analysis as suggested by the data itself and the underlying science For example, while we used a statistical test to quantify peaks in the melanoma study, we could have defined peaks based ... extension to n-ary classification systems (e.g dim, intermediate, bright) is possible After derivation of frequencies for all sets, data was loaded into a relational database (MySQL) and analyzed with...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Body fluid derived exosomes as a novel template for clinical diagnostics" pptx
... Darmstadt, Germany) in an ABI 7300 analyzer Primers used for determining mRNA expression levels were as follows: CD24 fwd 5’-TGC CTC GAC ACA CAT AAA CC3’, CD24 rev 5’-GTG ACC ATG CGA ACA AAA ... AAA GA-3’; GAPDH fwd 5’-ACA CCC ACT CCT CCA CCT TT-3’, GAPDH rev 5’-TGC TGT AGC CAA ATT CGT TG-3’ To compare and quantify different measurements a cellular cDNA was used as standard and the amount ... esRNA was analyzed by PCR (C) Total RNA was isolated from amniotic fluid and urine exosomes and analyzed via an Agilent Bioanalyzer The results show that exosomes contain variable amounts of 18 and...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
... Pain and self-reported characteristics Self-rated pain was assessed as pain at the moment and measured within a week before the day of testing on a blank 100 mm visual analogue scale (VAS), on ... non-traumatic neck pain in a working age population Other possible applications that may need further exploration is for rehabilitation of acute neck pain, whiplash associated disorders and diseases ... engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for graphical work References Competing interests The study was supported by funding from Alfta...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Body fluid derived exosomes as a novel template for clinical diagnostics" ppt
... Darmstadt, Germany) in an ABI 7300 analyzer Primers used for determining mRNA expression levels were as follows: CD24 fwd 5’-TGC CTC GAC ACA CAT AAA CC3’, CD24 rev 5’-GTG ACC ATG CGA ACA AAA ... AAA GA-3’; GAPDH fwd 5’-ACA CCC ACT CCT CCA CCT TT-3’, GAPDH rev 5’-TGC TGT AGC CAA ATT CGT TG-3’ To compare and quantify different measurements a cellular cDNA was used as standard and the amount ... esRNA was analyzed by PCR (C) Total RNA was isolated from amniotic fluid and urine exosomes and analyzed via an Agilent Bioanalyzer The results show that exosomes contain variable amounts of 18 and...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt
... resistance To calculate the contact resistance, Mg was evaporated on the n-Si wafer, and the Ag paste was printed on the Si wafer for reference The contact resistances of Mg/Si and Ag/Si were measured ... Mater Sol Cells 2002, 73:209-219 Hilali MM, Nakayashiki K, Khadilkar C, Reedy RC, Rohatgi A, Shaikh A, Kim S, Sridharan S: Effect of Ag particle size in thick-film Ag paste on the electrical and ... ohmic contact with an n+ region, a new material can be inserted between Ag and Si to form low barrier height (ΦB) and thus to reduce the contact resistance Among various materials, Mg metal is selected...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf
... we can estimate DOAs and delays with only three MUSIC algorithm executions The original TSaT-MUSIC algorithm is for DOA-delay estimation in a 2D space and can easily be extended to a localization ... method in a 3D space One advantageous point of MUSIC algorithms used for 3D localization is that we can design a compact receiver array In this study, a small L-shaped receiver array (about 36 ... this article as: Mizutani et al.: TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization EURASIP Journal on Advances in Signal Processing 2011 2011:101 when a true point...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
... what we have in the corner points of the sum-capacity facet, we assume that all cancellations are perfect, and what is forwarded to the next decoder EURASIP Journal on Wireless Communications and ... show the Average AME for the six methods which are compared As it was already pointed out previously, OMA achieves always the maximum possible AME We can notice from Figure 2(b) that SIC and TS ... BORG∗ K is guaranteed to be max-min fair among all possible user groupings for which the sum capacity is achieved We investigate how the fairness can be evaluated for OMA, SIC, and BORG In this...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Research Article A Novel Criterion for Writer Enrolment Based on a Time-Normalized Signature Sample Entropy Measure" pptx
... databases Such statistical approaches gave indeed the best signature verification results in the last Signature Evaluation campaign in the framework of BioSecure Multimodal Evaluation Campaign ... functions available on all sorts of databases, whether acquired on fixed platforms (as digitizing tablets) or on mobile platforms (as Personal Digital Assistants) The entropy of a random variable only ... variability criteria were proposed for offline signature verification by a human expert A human operator labels signatures according to both criteria and their impact on performance is studied Also...
Ngày tải lên: 21/06/2014, 19:20