anyway an actuary is a person who

27651 find a person who likes

27651 find a person who likes

... likes dancing ...

Ngày tải lên: 11/10/2016, 07:02

2 239 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... a margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate ... you answer The algorithm used to build a score is more complicated than that This means that you can make a silly mistake and answer incorrectly and that the computer will recognize that item as...

Ngày tải lên: 20/01/2014, 20:20

696 1K 1
Báo cáo khoa học: An estrogen receptor a suppressor, microRNA-22, is downregulated in estrogen receptor a-positive human breast cancer cell lines and clinical samples pptx

Báo cáo khoa học: An estrogen receptor a suppressor, microRNA-22, is downregulated in estrogen receptor a-positive human breast cancer cell lines and clinical samples pptx

... follows: ERa siRNA #2 sense strand 5¢-UCAUCGCAUUCC UUGCAAAdTdT-3¢, antisense strand 5¢- UUUGCAAGGAAUGCGAUGAdTdT-3¢; ERa siRNA #3 sense strand 5¢- GGAGAAUGUUGAAACA CAAdTdT-3¢, antisense strand 5¢- ... Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi T (2006) A polycistronic microRNA cluster, miR-17-92, is overexpressed in human ... serve as a potential therapeutic reagent in the treatment of cancer in which ERa plays an important role Materials and methods MicroRNA-22 and estrogen receptor a RNA isolation and quantitative...

Ngày tải lên: 22/03/2014, 21:20

11 237 0
Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses

Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses

... Microsoft and their partners • Nokia brings proven capability and talent in critical areas • Ongoing share growth and the synergies across marketing, branding, and advertising Nokia • Be the best path ... organizations or companies join together to become a new business • In an acquisition: one business buys a second and generally smaller company Goals Increase in top line revenue Expand in a declining ... the regular basis on the combination Geography • • • • Affect adverse selection and moral hazard problems in M &A Hinder acquisitions’ efforts to assess the true value Hamper acquisitions’ ability...

Ngày tải lên: 08/05/2014, 17:42

17 724 8
báo cáo sinh học:" How labour intensive is a doctor-based delivery model for antiretroviral treatment (ART)? Evidence from an observational study in Siem Reap, Cambodia" potx

báo cáo sinh học:" How labour intensive is a doctor-based delivery model for antiretroviral treatment (ART)? Evidence from an observational study in Siem Reap, Cambodia" potx

... collection, analysed the data, and wrote successive drafts of the manuscript Katharina Kober participated in the design of the study, participated in data collection and data analysis, and reviewed ... of care, but also at the level of care teams, health care facilities, and support systems These different layers of learning and adaptation can potentially have a multiplication effect, and may ... realistic, but the extrapolation is mainly intended to reveal the stakes in the domain of human resources There are many districts in sub-Saharan Africa where adult HIV prevalence is stable around...

Ngày tải lên: 18/06/2014, 17:20

9 451 0
báo cáo hóa học: " “Case files from the University of Florida: When an earache is more than an earache": A case report" potx

báo cáo hóa học: " “Case files from the University of Florida: When an earache is more than an earache": A case report" potx

... meningitis and brain abscess Infect Dis Clin North Am 23(3):609-23 Mamelak AN, Mampalam TJ, Obana WG, et al: Improved management of multiple brain abscesses: a combined surgical and medical approach ... requested admission for observation The ED physician agreed and consulted the pediatric admission team to evaluate the patient After admission was arranged there was a delay in transporting the patient ... both ears, with bulging tympanic membranes and decreased light reflex The throat was normal The lungs were clear to auscultation bilaterally, and the heart exam was unremarkable He had a soft and...

Ngày tải lên: 21/06/2014, 02:20

5 329 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC t p.G60V ... Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... development, and can lead to malformation of any organ that is asymmetric along the LR axis Heterotaxy is classically associated with heart malformations, anomalies of the visceral organs such as gut malrotation,...

Ngày tải lên: 09/08/2014, 23:20

36 447 0
Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

... showed that variables from the personal factors (age and sex), parental factors (parental marital status and father’s occupation), general health factors (self-esteem, anxiety and depression) and ... 0.0001) Covariance analysis It was necessary to analysis of covariance in order to understand the impact of anxiety, depression, selfesteem and difficulty with studies and social relations on ... instrument, based on a conceptual framework, and we analyzed our data in such a way as to make QOL data clinically relevant as a population health measure We needed to modify the item on sexual activity...

Ngày tải lên: 11/08/2014, 15:22

12 500 0
Báo cáo y học: "Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study" pptx

Báo cáo y học: "Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study" pptx

... NG, JS and AB are employees of BRAHMS AG, the manufacturer of the pro-ANP assay (BRAHMS Seristra® LIA; BRAHMS AG, Hennigsdorf/Berlin, Germany) BM has served as a consultant and received payments ... study was 57 ± 15 years (range 23–86 years) and the mean APACHE II score on admission was 22 ± The median length of stay in the medical ICU was days (range 0.2–60 days) and the mortality rate was ... denote median values, boxes represent 25th to 75th percentiles and whiskers indicate the range ANOVA, analysis of variance As is generally recommended, we diagnosed sepsis, severe sepsis and septic...

Ngày tải lên: 12/08/2014, 20:20

9 254 0
Báo cáo y học: "Spontaneous hypothermia on intensive care unit admission is a predictor of unfavorable neurological outcome in patients after resuscitation: an observational cohort study" pptx

Báo cáo y học: "Spontaneous hypothermia on intensive care unit admission is a predictor of unfavorable neurological outcome in patients after resuscitation: an observational cohort study" pptx

... AdH and LR retrieved the data and built the database AdH performed the analysis and wrote the manuscript drafts ACdP designed the study and coached the analysis JB performed the statistical analysis ... statistical analysis and MJS and JH coached the analysis and supervised the project All authors contributed in the writing and the critical appraisal of the manuscript All authors read and approved ... as favorable Statistical analysis Data were analyzed using the Statistical Package for Social Sciences (SPSS) for Windows, version 15.1 (SPSS, Chicago, IL, USA) Patient characteristics were analyzed...

Ngày tải lên: 13/08/2014, 20:22

5 407 0
Renewable energy is a challenge, but also an opportunity for new industries, employment, and new ways to reduce dependency on fuel imports, provide electricity to poor remote areas, reduce air pollution

Renewable energy is a challenge, but also an opportunity for new industries, employment, and new ways to reduce dependency on fuel imports, provide electricity to poor remote areas, reduce air pollution

... the analysis On this basis, the theoretical installed wind capacity potential for Cambodia, the Lao PDR, Myanmar, Thailand, and Viet Nam was estimated to be 888 gigawatt (GW), and the theoretical ... Agriculture and Cooperatives (Thailand) – Ministry of Agriculture and Irrigation (Myanmar) – Ministry of Energy (Myanmar, Thailand) – Ministry of Electric Power (Myanmar) – Ministry of Finance (Viet Nam) ... ministries and business and community leaders about international best practices and expertise in renewable energy and energy efficiency As a highly operational bank backed by substantial technical and...

Ngày tải lên: 08/09/2015, 23:32

168 634 0
The structure of an imperial chinese city  a person environment study on linan (1123 1278

The structure of an imperial chinese city a person environment study on linan (1123 1278

... similar to landmarks, anchor points also exist in hierarchy, but the hierarchy is based on cognitive saliency rather than spatial scale or visual dominance of landmarks Another relevant theoretical ... features, and spatial relations among phenomena A map normally consists of points (landmark and node), lines (route and path) and areas (regions, neighbourhoods), as well as surfaces (3D characteristics) ... cognitive schemata, e.g landmark was actually defined partly on socio-cultural variables: meanings, names, associations and preference rankings, as well as the perceptual and locational prominence...

Ngày tải lên: 17/09/2015, 17:20

279 558 0
Who is a stream  epistemic communities, instrument constituencies and advocacy coalitions in public policy making 1 2

Who is a stream epistemic communities, instrument constituencies and advocacy coalitions in public policy making 1 2

... once again to resume their parallel courses (Teisman, 2000; Zahariadis, 2007) And yet others have suggested that additional streams emerge and can become apparent through and beyond agenda setting, ... similar, traditional, entrepreneurs exist (Zahariadis, 2007) As Ackrill, Kay and Zahariadis (2013) note, this means “no entrepreneur alone will ever be enough to cause policy reform; we always ... area And instrument constituencies, like advocacy coalitions, wax and wane as solution-based activity occurs, being actively engaged in formulation, less so in decision-making and then again actively...

Ngày tải lên: 22/09/2015, 15:18

11 274 0
Who is a stream  epistemic communities, instrument constituencies and advocacy coalitions in public policy making 1

Who is a stream epistemic communities, instrument constituencies and advocacy coalitions in public policy making 1

... Frank Fischer, Gerald Miller, and Mara Sidney, Eds., Handbook of Public Policy Analysis, Taylor & Francis Stone, Deborah A 1989, “Causal stories and the formation of policy agendas” Political ... construed as antithetical to the MSF, namely the Advocacy Coalition Framework (ACF) As is well known, the ACF was advanced during the 1980s by Paul Sabatier and Hank Jenkins-Smith as a response ... This activity involves the definition of policy goals (both broad and specific) and the creation of the means and mechanisms to realise these goals The article argues this stage is best analyzed...

Ngày tải lên: 22/09/2015, 15:18

19 276 0
w