any other circumstance of a substantive nature affecting intangible assets such as leases insurance litigation attachments and similar situations

Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc

Ngày tải lên : 19/01/2014, 02:20

... 1, January 1991, pp 62-72 [2] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Dead Beat Control of threePhase PWM Inverter", IEEE Transactions on Power Electronics, Vol 5, No 1, January ... that it does not affect the output voltage References [1] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Digital Control of three-Phase Inverter with LC Filter", IEEE Transactions on Power ... way the battery will be alway charged a the Maxim t w ys at mum Power P Point The go of the sy oal ystem illustra ated in figure is to supply th as well as single ph i s hree hase loads of any...

9
650
0

Báo cáo khoa học: Characterization of a hemocyte intracellular fatty acid-binding protein from crayﬁsh (Pacifastacus leniusculus) and shrimp (Penaeus monodon) pdf

Ngày tải lên : 23/03/2014, 10:21

... 596– ACGAGGAAGCGAAGGATGA TGATGG) were chosen to amplify a 139-base pair fragment of the plFABP Primers speciﬁc to the crayﬁsh ribosomal 40S gene (156+ GACGAATGGCATACACCTGAG AGG and 280– CAGGACTCTGCAGTTCAAGCTGATG) ... (msCRABP, AAC24317) and also with other arthropod FABPs [6] The amino-acid sequence of plFABP, as well as that of pmFABP, shows identity with vertebrate CRABPs and FABPs of 35–45% and similarity of ... ensis has been shown to bind retinoic acid (RA) and retinal [4], and another recombinant putative CRABP from Manduca sexta [5] has been found to bind saturated as well as unsaturated fatty acid,...

11
545
0

báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc

Ngày tải lên : 18/06/2014, 15:20

... PBMC was evaluated Calibration standard curve and linearity of dilution Due to the lack of a standard reference material, calibration standard curves were not evaluated for quantification of cellular ... one patient, as an example, was detected by all three validated clinical assays, HLA -A2 MART-1 tetramer assay, IFNγ real time RT-PCR and ELISPOT (Figure and Table 10), demonstrating the assay utility ... Accuracy, spike and recovery, and LOQ Due to the lack of a reference standard material to establish a true value, assay accuracy, spike and recovery, and LOQ were not examined Page 14 of 25 (page number...

25
639
0

Báo cáo lâm nghiệp: "Evapotranspiration of a declining Quercus robur (L.) stand from 1999 to 2001. I. Trees and forest floor daily transpiration" ppsx

Ngày tải lên : 08/08/2014, 00:22

... importance of LAI as a limiting factor of stand transpiration has been demonstrated [19] For each year and each plot, T/LAI was calculated for oaks and was always < 0.3 Except for 2001, T/LAI was ... Intra- and inter-annual variations of transpiration, leaf area index and radial growth of a sessile oak stand (Quercus petraea), Ann For Sci 53 (1996) 521–536 [22] Granier A. , Anfodillo T., Sabatti ... For Acer, SA was respectively 0.24 m2 ha–1 and 1.45 m2 ha–1 Sapflow sensors were replaced each year Oak and maple daily stand transpiration (T, mm d–1) were calculated as follows [7]: tilators...

10
365
0

Báo cáo khoa học: "Growth and fructification of a Norway spruce (Picea abies L. Karst) forest ecosystem under changed nutrient and water input" doc

Ngày tải lên : 08/08/2014, 14:20

... stand was planted in 1933 and as a result of several silvicultural measures was thinned to 900 trees ha–1 by the beginning of the project (1990) The stand was then 57 years old and had an average ... Finally the precipitation of the stand – depending on the roof area and experiment in natural or chemically changed form – was transported via a pipe system back underneath the roofs and released ... original control trees at the side of the roofs and close to the crane foundation) are all within reach of the crane The radial growth was measured with radial measuring bands, which were permanently...

10
178
0

Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps

Ngày tải lên : 09/08/2014, 18:21

... A T C G - 41- G T A A - A T T A G C T G A C A A A A C C T A A A G T C C A G C C C A A A A C A A T A A A C T A A T C C C C T C C A C C C C A T T A C C C C A A A A C T T C A C C A A A A G G A A ... and are CT; and lanes 4, and 10 are TT was not consistently different between the sequenced lean and fat bulls, and because alanine and valine are both amino acids with similar non-polar aliphatic ... 2.4 RNA extraction and ribonuclease protection assay (RPA) Adipose tissue was collected at slaughter and the total RNA was extracted using TRIzol reagent (Life Technologies) Transcribed antisense...

12
321
0

Báo cáo y học: " Prenatal exposure of a girl with autism spectrum disorder to ‘horsetail’ (Equisetum arvense) herbal remedy and alcohol: a case repor" ppsx

Ngày tải lên : 11/08/2014, 00:23

... MGA, APM, EMS, LC and OPS analyzed and interpreted data from our patient regarding the disease All authors read and approved the final manuscript Page of 10 Oliveira FA, Galan DT, Ribeiro AM, ... horsetail exposure and ASD Case presentation We present the case of a three-year-old Caucasian girl with ASD, focusing on her PEH (Table 1) She was born after 41-weeks gestation via caesarean section ... degree of bilirubin level elevation were not at increased risk of ASD Antenatal ultrasound Antenatal ultrasound is unlikely to increase the risk of ASD (case-control study) Ammonium perchlorate...

5
218
0

Báo cáo y học: "Recovery of fitness of a live attenuated simian immunodeficiency virus through compensation in both the coding and non-coding regions of the viral genome" pot

Ngày tải lên : 13/08/2014, 05:22

... analysis of cellular RNA was also conducted in parallel RNA extraction was carried out in similar fashion to that described for slot blotting above Cellular RNA from lysates was normalized on the basis ... run with RNA template, digested by DNase-free RNase, served as a negative control for each sample to exclude any potential DNA contamination Relative amounts of viral RNA that were packaged were ... Figure Native analysis of virion-associated RNA Native analysis of virion-associated RNA Mutant or wild-type virus was purified by sucrose gradient ultracentrifugation Virion RNA was then extracted...

10
213
0

Characterization of diffusion behavior of a novel extra cellular sphingolipid associated peptide probe by fluorescence correlation spectroscopy and imaging total internal reflection fluorescence correlation spectroscopy

Ngày tải lên : 12/09/2015, 09:55

... rafts form and disperse rapidly and capriciously, and can also coalesce and disintegrate [95] Consistent with the model, this dynamic partitioning of diffusive behavior of raft associated markers ... Role of lipid rafts in signal transduction pathways Due to their ability to diffuse laterally on the plasma membrane, rafts can act as floating shuttles that transport and bring together activated ... transduction pathways within selected areas of the plasma membrane [3] 1.2.5.2 Role of lipid rafts as platforms for entry of pathogens A broad range of pathogens, including viruses, bacteria,...

177
361
0

A study on some major factors affecting English learning of grade 6 ethnic minority students of a mountainous secondary school to help them learn better

Ngày tải lên : 07/11/2012, 15:04

... Personality characteristics Second language acquisition is defined as the learning and adopting of a language that is not your native language Once you have acquired a foreign language, you have mastered ... simplicity, ease or difficulty of learning, degree of important, elegance, social status, etc Attitudes towards a language may also show what people feel about the speakers of that language Language attitudes ... Community attitudes towards the language being learnt can have a profound impact on SLA where the community has a broadly negative view of the target language and its speakers, or a negative view of...

39
1.5K
6

Would a Roshanda by Any Other name smell as sweet

Ngày tải lên : 17/10/2013, 18:20

... Girl Names Sarah Emily Jessica * See note, p 303 174 Lauren Ashley Amanda A Roshanda by Any Other Name Megan Samantha Hannah 10 Rachel 11 Nicole 12 Taylor 13 Elizabeth 14 Katherine 15 Madison ... brand names (Lexus, Armani, Bacardi, Timberland) and what might be called aspirational names The California data show eight Harvards born during the 1990s (all of them black), ﬁfteen Yales (all ... 17 Alexandra 18 Brittany 19 Danielle 20 Rebecca Most Common Low-Income White Girl Names Ashley Jessica Amanda Samantha Brittany Sarah Kayla Amber Megan 10 Taylor 11 Emily 12 Nicole 13 Elizabeth...

26
589
0

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in ﬁssion yeast doc

Ngày tải lên : 18/02/2014, 14:20

... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...

16
646
0

Tài liệu Báo cáo khoa học: Solution structure of crotamine, a Na+ channel affecting toxin from Crotalus durissus terriﬁcus venom docx

Ngày tải lên : 20/02/2014, 11:20

... heavy (line) atoms ˚ residual distance violations not greater than 0.5 A and dihedral violations not more than 5° As already suggested by previous studies [37,38] the molecule has a flat shape and ... mean rmsd values from the ˚ idealized covalent bond (0.002 A) and covalent angles (0.90°) indicate the absence of stereochemical distortions An assessment of the local variability of backbone and ... from snake venom active on Na+ channel Materials and methods Isolation of crotamine Native crotamine was isolated and purified from the yellow venom of the snake Crotalus durissus terrificus as described...

11
460
0

A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc

Ngày tải lên : 06/03/2014, 03:21

... borderland between Klein Namaqualand, and Gordonia, Cape Colony, and what was at that time known as German South- West Africa Four of them appeared a few years back in The State an illustrated magazine ... scarce be able to struggle back to the nearest t'samma we had left, and in any case, to go back, beaten! No, if Inyati gave any hope at all, I would push on as long as life lasted So I lay and ... however, was useless to us, as our way was east or north-east, and in this direction all Inyati's reconnoitering failed to discover anything but bare dunes, as far as the eye could reach Pleasant as...

160
619
1

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... sheets and 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal ... currently aimed at achieving a detailed understanding of the roles of the numerous components of the MVB sorting machinery Vps4 is an ATPase of the AAA (ATPase associated with a variety of cellular activities)...

23
490
0

Comparison of composition (nutrients and other substances) of organically and conventionally produced foodstuffs: a systematic review of the available literature doc

Ngày tải lên : 28/03/2014, 19:20

... Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable paper Unobtainable ... studies may have been lost These analysis and interpretation decisions were applied as the review was designed to make the best use of all available data and to present the data in a standardised ... Preparation Handling of samples prior to laboratory analysis Packaging Packaging of sample as available to consumer (basket studies) Other Additional information not covered previously Source of...

209
726
0

báo cáo hóa học:" Mid-term results and factors affecting outcome of a metal-backed unicompartmental knee design: a case series" pptx

Ngày tải lên : 20/06/2014, 04:20

... femoral and tibial angles, alpha and beta angles, and medial and lateral joint spaces as described by Villers and Cartier [7] Patients were additionally evaluated for the presence of patellar osteophytes ... the same patient (A) and Merchant view at radiographs of Antero-posterioras Figures and 2, taken(B) 41 month folAntero-posterior (A) and Merchant view (B) radiographs of the same patient as Figures ... standard deviation ap values were calculated based on Wilcoxon matched-pairs signed-ranks tests for continuous variables and chi-squared tests for categorical variables a mean of 95 (SD = 4) and...

7
272
0

Báo cáo hóa học: " Mechanics of lipid bilayer junctions affecting the size of a connecting lipid nanotube" pptx

Ngày tải lên : 21/06/2014, 03:20

... development and analysis of experimental data, physical interpretation of results and writing the manuscript KLA and MK have contributed to the experimental part of the study RK, MK, AGE, and ASC have ... the related publication [11], where a phenomenological description of the system was suggested and only a qualitative consistency with experimental data was obtained Experimentals Materials and ... quantitative analysis of TOC and TVC and explains why the length of the LNT in the TVC is twice as high as in TOC for a given radius Furthermore, the model has just two parameters, which can...

6
226
0

Báo cáo lâm nghiệp: " Growth of wild cherry (Prunus avium L.) in a mixture with other species in a demonstration forest" ppsx

Ngày tải lên : 07/08/2014, 03:22

... lime and alder (in accordance with their share of BA) Basic data on the stand species composition and mean stem are given in Table Average stand height is about 21 m, which is reached by stand-forming ... well as its capacity to keep its position in a stand MATERIAL AND METHODS A large stand with wild cherry trees as a standforming species in the area of Demonstration Forests in Kostelec nad Černými ... the nearest 0.5 m), size of the crown (vertically and horizontally) and tree class evaluation (according to Konšel’s classification) The stand is at an altitude of about 350 m above sea level;...

6
357
0