and or volume of a rock body

... tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit pulmonary artery and rat portal vein, two NK-2 receptor bioassays [43] More recently, ... same Ala substitution was reported to cause a significant decrease in biological activities of [Ala8]NKA measured in human tissues [44] Indeed, [Ala8]NKA(4–10) was shown to be a weak partial agonist ... Computational studies confirm that the conformational space of b-amino acids is larger than that of a- amino acids, but low-energy conformations of the b-amino acids backbone, corresponding to gauche...

Ngày tải lên: 08/03/2014, 08:20

... clear mucus toward the natural ostium It is possible that the foreign body dislocated near the maxillary natural ostium created an antral inflammation of the overlying mucosa and a disturbance ... infraorbital region and nasal stuffiness In this case a small bone window in the lateral wall of the maxillary sinus was performed in order to obtain a contemporary endodontic surgical treatment ... roots body located in molar Computed tomography scan (coronal plane) showing the foreign body located in the supero medial aspect of the maxillary sinus and partial mucosal thickening of the...

Ngày tải lên: 11/08/2014, 23:22

... performed the experimental work, conducted the data analysis and drafted the manuscript FG and HK participated in the data analysis and review of the manuscript YN performed project planning, participated ... planning, participated in the data analysis and helped to draft the manuscript All authors read and approved the final manuscript Weissman AM: Themes and variations on ubiquitylation Nat Rev Mol Cell ... marker for AP-1 [41]; δ-adaptin, a marker for AP-3 [42] Both AP-1 and AP-3 localizes to TGN and endosomes, with AP-3 localizes more to endosomes [43] UL56 colocalized with both γadaptin and δ-adaptin,...

Ngày tải lên: 12/08/2014, 04:20

... standardised to have a mean of and a standard deviation of within each sex and population (see below) 583 Reciprocal introgression of a growth QTL Table II Means and standard deviations for body ... transformed to have a mean of and a standard deviation of within each sex and population (i.e., by subtracting the mean and dividing by the standard deviation of the appropriate sex and population) ... LinH and HinL combined 10-week body mass (g) a a 585 For the analysis combining the LinH and HinL populations, the 10-week body mass data were first transformed to have a mean of and a standard...

Ngày tải lên: 14/08/2014, 13:22

... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated biodiesel fuel A general ... Director of Entrance Examinations, Anna University, Chennai He has published more than 40 international articles, 37 international conference papers, national journal papers, and 21 national conference...

Ngày tải lên: 05/09/2013, 15:28

... Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million ... Proudyogiki Vishwavidyalaya (R.G.P.V.) Jatropha plant bears fruits from second year of its plantation and the economic yield stabilizes from fourth and fifth year onwards The plant has an average life ... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing...

Ngày tải lên: 05/09/2013, 16:11

... subtropical southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... Rice G Performance of rapeseed oil blends in diesel engines Journal of Applied Energy 1996;64(4): Agarwal D.; Lokesh Kumar, and Agarwal, A. K 2008 Performance evaluation of a vegetable oil fuelled...

Ngày tải lên: 05/09/2013, 16:11

... Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called mers with low on-state voltage igbts ... higher than for the MERS case The influence of actual switch characteristics and thermal capability has been investigated An average peak junction temperature of 125°C and 80°C heat sink temperature ... generator voltage and the maximum output power can be increased A configuration using a variable series compensation device called a magnetic energy recovery switch (MERS) and a diode bridge has...

Ngày tải lên: 15/10/2013, 16:11

Ngày tải lên: 17/10/2013, 10:11

... on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal state variable which is physically meaningful : that ... pulsating torque (the homopolar part) and a two-phase motor with a rotating field (the "ap" The classical Park transformation is, in fact, the succesion of two transformations The first trandormation ... saturation, L, and M, are constant ara arb , and arc the rotor fluxes induced in the stator phases are The electrical equations of the machine can therefore be written as follows : are the backemf...

Ngày tải lên: 03/01/2014, 19:44

... subunit molecular mass was also estimated by SDS–PAGE Characterization and comparative analyses of HYDJs and HYDBp The optimal temperature for activity of HYDJs with d-pHPH as substrate was determined ... putative allantoate amidohydrolase, which is part of the urate catabolic pathway in many organisms [8] In fact, by genome data mining, another hydantoinase (HYD) was also found in the Jannaschia sp ... degradation pathway of uracil, thymine and several anti-cancer drugs [38] Interestingly, annotation of the DNA sequences flanking the Jannaschia sp CCS1 HYDJs revealed an ORF encoding a putative allantoate...

Ngày tải lên: 18/02/2014, 08:20

... G-25 was purchased from Amersham Biosciences (Uppsala, Sweden), a ZORBAX 300SB-C18 semipreparative column was from Agilent Technologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile ... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... assigned and integrated, with concomitant cycles of structure calculations for evaluation of distance and angle constraint violations as well as assignments of additional peaks based on the preliminary...

Ngày tải lên: 18/02/2014, 17:20

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...

Ngày tải lên: 19/02/2014, 06:20

... points of the proteins (52.32 °C for the wild-type and ‘not detectable’ for W14 0A and W140O) Flanagan et al [15] reported that multiple mutations can cause large changes in the average conformation ... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... conformation of denatured proteins Here we show that a specific single mutation or removal of a specific fragment can cause large changes in the native state of SNase Fig Steady-state fluorescent spectra of...

Ngày tải lên: 20/02/2014, 01:20

... AWAWALGWDDK GYHENA WPLDYFL TTCTTCAAGGGCTGGCTCCCT CTGATCTAGAGGTACCGGATCC ATCCTCACGAACAAGCAG GATCGCGATGCAGGCCTT GGACGACTACAGCGTCTTCAGTAGA TCCAAACAGTCAGTTTCTTAACCGT Ó FEBS 2003 cDNA cloning of abalone ... template DNA, and 0.05 unitsỈmL)1 TaKaRa Taq DNA polymerase A successive reaction at 95 °C for 30 s, 45 °C for 60 s and 72 °C for 90 s was repeated for 30 cycles with a PC 700 Program Incubator (ASTEC, ... Fukuoka, Japan) cDNAs for 5¢ -and 3¢-terminal regions of mRNA were amplified with a 5¢-Full RACE kit and a 3¢-Full RACE kit (TaKaRa, Tokyo, Japan), respectively Genomic PCR was performed with DNA primers...

Ngày tải lên: 20/02/2014, 23:20

... spread on a CaF2 crystal and allowed to stand at room temperature until all free water was evaporated After this, IR spectra were recorded at room temperature and at 37 °C Usually, the original ... substrate is cleaved enzymatically, and the product can be measured photometrically This was carried out on an ELISA reader (Rainbow, Tecan, Crailsham, Germany) at a wavelength of 450 nm, and the ... Mycoplasma fermentans has been reported to accompany several diseases such as rheumatoid arthritis and HIV [6] For the former, the mycoplasma organisms may be a cofactor in the pathogenesis, but its...

Ngày tải lên: 21/02/2014, 00:20

... Gramnegative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria ... charge of parabutoporin, this could explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial ... venom of spiders and insects Parabutoporin and opistoporin were synthesized chemically and preliminary studies on antibacterial activity showed that the quality and biological activity of native and...

Ngày tải lên: 21/02/2014, 15:20

... states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial ... the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges...

Ngày tải lên: 06/03/2014, 15:21

... 48.67 A, b ¼ 74.38 A, c ¼ 64.18 A and ˚ resolution b ¼ 108.6°, and diffracted to at least 1.5 A Crystal data and data collection statistics are summarized in Table Calculation of the Matthews ... L, Hamid Q & Elias JA (2004) Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation Science 304, 1678– 1682 Kasprzewska A (2003) Plant chitinases ) regulation and ... and Svein Horn for helpful discussions The authors acknowledge the beamline staff at ID14-EH3 for technical assistance, and the ESRF and the Norwegian Research Council (project Sygor) for financial...

Ngày tải lên: 07/03/2014, 11:20

... extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank Accession No AY249052) ... then a final extension at 72 °C for 10 before storage at °C Amplification products were fractionated by electrophoresis in 2.0% agarose/Tris borate/EDTA gels and appropriate bands excised and purified ... developmental cycle: early, middle and late substrate colonization stages (4, and 12 days); pinhead stage (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22) and mature stage...

Ngày tải lên: 07/03/2014, 15:20