and a half generation 2 5g

Control of Robot Manipulators in Joint Space - R. Kelly, V. Santibanez and A. Loria Part 2 potx

Control of Robot Manipulators in Joint Space - R. Kelly, V. Santibanez and A. Loria Part 2 potx

... a1 1 ⎢ a2 1 A = {aij } = ⎢ ⎣ a1 2 a2 2 ··· ··· an1 an2 · · · anm A vector x ∈ IRn may be interpreted as a particular matrix belonging to IR = IRn The matrices are denoted by Latin capital ... the matrices A ∈ IRm×p and B ∈ IRp×n The product of matrices A and B denoted by C = AB ∈ IRm×n is defined as C = {cij } = AB a 11 ⎢ a2 1 =⎢ ⎣ a1 2 a2 2 ··· ··· am1 am2 · · · amp a1 p a2 p ... xTAx = 0, for all x ∈ IRn A square matrix A = {aij } ∈ IRn×n is diagonal if aij = for all i = j We denote a diagonal matrix by diag {a1 1 , a2 2 , · · · , ann } ∈ IRn×n , i.e ⎡ a1 1 ⎢ diag {a1 1 , a2 2...

Ngày tải lên: 10/08/2014, 01:23

30 308 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8 ... Chelvanayagam G, Heringa J & Argos P (19 92) Anatomy and evolution of proteins displaying the viral capsid jellyroll topology J Mol Biol 22 8, 22 0 24 2 Anand K, Pal D & Hilgenfeld R (20 02) An overview...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical ... REFERENCES Fujisawa, H & Hayaishi, O (1968) Protocatechuate 3,4-dioxygenase I Crystallization and characterization J Biol Chem 24 3, 26 73 26 81 Murakami, S., Nakanishi, Y., Kodama, N., Takenaka, S., Shinke, ... 1.4 2. 4 lm and motile with peritrichous flagella It is aerobic, Gram-negative, nonsporeforming, urease-negative, and catalase- and oxidase-positive It oxidatively produced a small amount of acid...

Ngày tải lên: 21/02/2014, 01:21

7 490 0
Báo cáo khoa học: "Test Collection Selection and Gold Standard Generation for a Multiply-Annotated Opinion Corpus" potx

Báo cáo khoa học: "Test Collection Selection and Gold Standard Generation for a Multiply-Annotated Opinion Corpus" potx

... In case A and case D, the polarities annotated by annotators are identical In case B, the polarities annotated by two of three annotators are agreed However, in cases C and E, the polarities annotated ... annotations of relevance 4 .2 High agreement To see how the generated gold standards agree with the annotations of all annotators, we analyze the kappa value from the agreements of each annotator ... J., Zhu, Y Gao, Y and Yin, H tong2yi4ci2ci2lin2 Shanghai Dictionary Press, 19 82 Pang, B., Lee, L., and Vaithyanathan, S (20 02) Thumbs up? Sentiment classification using machine learning techniques...

Ngày tải lên: 08/03/2014, 02:21

4 418 0
Báo cáo khóa học: Assembly of the silk fibroin elementary unit in endoplasmic reticulum and a role of L-chain for protection of a1,2-mannose residues in N-linked oligosaccharide chains of fibrohexamerin/P25 ppt

Báo cáo khóa học: Assembly of the silk fibroin elementary unit in endoplasmic reticulum and a role of L-chain for protection of a1,2-mannose residues in N-linked oligosaccharide chains of fibrohexamerin/P25 ppt

... We thank Kazuko Seo and Hiroko Yamazaki, National Institute of Agrobiological Sciences, for technical assistance, and Dr Masahiro Tomita and Dr Katsutoshi Yoshizato, Hiroshima Tissue Regeneration ... lane 3) or in cocoons (Fig 3A, lane 1) The 30-kDa fhx/P25 was converted to the 27 -kDa single band by digestion with the bacterial a1 ,2- mannosidase (Fig 3A, lanes 4–6), and the 30- and 27 -kDa ... a1 ,2- mannosidase or endo-H (Fig 3A) Fhx/P25 was detected as a 30-kDa single band in the ER extract (Fig 3A, lane 2) but as two bands (30 and 27 kDa) in the ER plus Golgi mixed extracts (Fig 3A, ...

Ngày tải lên: 16/03/2014, 16:20

11 552 0
Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc

Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc

... Dynam.Earthquake Engrg., 22 , 923 - 930 (20 02) [22 ] Ma C.C and Lee G.-S., Transient elastic waves propagating in a multi-layered medium subjected to in-plane dynamic loadings II Numerical calculation ... )/(Nξ − 1) and the wn are the weights associated with the chosen quadrature scheme In fact, we evaluated the rectangular, trapezoidal, Simpson and various Matlab functions, and finally settled ... solved (Zhang & Chan, 20 03; Lai et al., 20 02) by inverting the times of arrival (TOAI) of body (Kikuchi & Kanamori, 19 82) and surface (Xia et al., 1999) waves in the displacement signal at one or...

Ngày tải lên: 18/03/2014, 01:21

26 468 0
Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

... pSTAT1, STAT1, pSTAT2, STAT2 and IRF9, in the cytoplasm and poly [ADP-ribose] polymerase for pSTAT1, STAT1, pSTAT2, STAT2 and IRF9 in the nucleus To smooth spline estimates of the data, MATLAB (http://www.mathworks.com) ... incubated with anti-IRF9 IgGs (Santa Cruz, CA, USA, antibody 10793) as primary antibody and anti-rabbit Alexa Fluor 680 (Invitrogen) as secondary antibody, and analysed by flow cytometry using a FACSCalibur ... concentrations result in earlier maximal pathway activation and an increase in signal amplitude [3,4] Furthermore, alterations in the activity of a kinase or phosphatase may affect the speed of signalling...

Ngày tải lên: 23/03/2014, 03:20

14 432 0
A computer system consists of hardware, system programs, and application programs figs 2

A computer system consists of hardware, system programs, and application programs figs 2

... Kernel picks a thread Possible: A1 , A2 , A3 , A1 , A2 , A3 Not possible: A1 , B1, A2 , B2, A3 , B3 Possible: A1 , A2 , A3 , A1 , A2 , A3 Also possible: A1 , B1, A2 , B2, A3 , B3 (a) (b) Fig 2- 43 (a) Possible scheduling ... threads over the use of a global variable Thread 1's code Thread 2' s code Thread 1's stack Thread 2' s stack Thread 1's globals Thread 2' s globals Fig 2- 17 Threads can have private global variables ... liberty, and dedicated to the proposition that all men are created equal Now we are engaged in a great civil war testing whether that nation, or any nation so conceived and so dedicated, can long...

Ngày tải lên: 28/04/2014, 16:35

45 347 0
the unfinished revolution how a new generation is reshaping family work and gender in america dec 2009

the unfinished revolution how a new generation is reshaping family work and gender in america dec 2009

... especially Michael Armato, Stephanie Byrd, Sarah Damaske, Adam Green, Pamela Kaufman, Allen Li, and Louise Roth, also offered valued feedback Over the years they have taught me as much as I taught ... when at least one parent had a flexible work arrangement and a child had access to good child care As a firefighter, Daniel’s father was able and eager—to far more than just fill in at home: She wasn’t ... Reared on a farm in the rural Northeast, Hannah listened to her mother regularly complain and blame her father—about lost chances and roads not taken: I hear about this ad nauseam! My mother was...

Ngày tải lên: 10/06/2014, 21:30

312 381 0
Báo cáo hóa học: "A randomized phase II trial of mitoxantrone, estramustine and vinorelbine or bcl-2 modulation with 13-cis retinoic acid, interferon and paclitaxel in patients with metastatic castrate-resistant prostate cancer: ECOG 3899" pot

Báo cáo hóa học: "A randomized phase II trial of mitoxantrone, estramustine and vinorelbine or bcl-2 modulation with 13-cis retinoic acid, interferon and paclitaxel in patients with metastatic castrate-resistant prostate cancer: ECOG 3899" pot

... Bcl -2/ actin ratio was 0.88 and 1. 32 on day and day of cycle 1, respectively, and the difference was not significant (p = 0.47) For Arm B, the average Bcl -2/ actin ratio was 1.55 and 1.00 on day and ... Three patients with measurable disease were stratified incorrectly to the non-measurable disease and elevated PSA stratum (2 Arm A patients and Arm B patient), while Arm A patient without measurable ... DiPaola RS: A phase I trial of weekly paclitaxel, 13- cis-retinoic acid, and interferon alpha in patients with prostate cancer and other advanced malignancies Cancer Chemother Pharmacol 20 03, 52: 119- 124 ...

Ngày tải lên: 18/06/2014, 16:20

9 463 0
Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx

Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx

... conservative distances and the Mazur–Ulam theorem Nonlinear Anal 47, 25 97 26 08 (20 01) [30] Xiang, S: Mappings of conservative distances and the Mazur–Ulam theorem J Math Anal Appl 25 4, 26 2 27 4 (20 01) ... Characterizations on Mazur–Ulam theorem Nonlinear Anal 72, 129 1– 129 7 (20 10) [21 ] Choy, J, Ku, S: Characterization on 2- isometries in non-Archimedean 2- normed spaces J Chungcheong Math Soc 22 , ... α -2- norm on a linear space corresponding to the 2- fuzzy 2- norm by using some ideas of Bag and Samanta [8] and also gave some fundamental properties of this space In 19 32, Mazur and Ulam [11] proved...

Ngày tải lên: 20/06/2014, 21:20

39 371 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot

báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot

... panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’ )2 fragments Panitumumab (Amgen) was ... et al: Cetuximab: Preclinical Evaluation of a Monoclonal Antibody Targeting EGFR for Radioimmunodiagnostic and Radioimmunotherapeutic Applications Cancer Biotherapy and Radiopharmaceuticals 20 08, ... digest and the protocol developed was readily scaled-up The in vitro analysis, SDS-PAGE and b a 24 h 48 h 24 h 48 h c 24 h 48 h 72 h 96 h Figure Validation of panitumumab F(ab’ )2 as an imaging agent...

Ngày tải lên: 21/06/2014, 02:20

15 452 0
Báo cáo hóa học: " Research Article Three Solutions for a Discrete Nonlinear Neumann Problem Involving the p-Laplacian Pasquale Candito1 and Giuseppina D’Agu`2 ı" pptx

Báo cáo hóa học: " Research Article Three Solutions for a Discrete Nonlinear Neumann Problem Involving the p-Laplacian Pasquale Candito1 and Giuseppina D’Agu`2 ı" pptx

... “Discrete and continuous: two sides of the same?” Geometric and Functional Analysis, pp a 359–3 82, 20 00 17 R P Agarwal, Difference Equations and Inequalities: Theory, Methods and Applications, vol 22 8 ... singular discrete p-Laplacian problems via variational methods,” Advances in Difference Equations, no 2, pp 93–99, 20 05 G Bonanno and P Candito, “Nonlinear difference equations investigated via critical ... singular and nonsingular discrete problems via variational methods,” Nonlinear Analysis: Theory, Methods & Applications, vol 58, no 1 -2, pp 69–73, 20 04 R P Agarwal, K Perera, and D O’Regan, “Multiple...

Ngày tải lên: 21/06/2014, 07:20

11 464 0
Báo cáo sinh học: " Research Article Aλ3 λ1 , λ2 , Ω -Weighted Inequalities with Lipschitz r and BMO Norms" doc

Báo cáo sinh học: " Research Article Aλ3 λ1 , λ2 , Ω -Weighted Inequalities with Lipschitz r and BMO Norms" doc

... maximal operators and ı fractional integrals on non-homogeneous spaces,” Indiana University Mathematics Journal, vol 50, no 3, pp 124 1– 128 0, 20 01 T Iwaniec and A Lutoborski, “Integral estimates ... Mathematical Analysis and Applications, vol 25 6, no 1, pp 3 12 323 , 20 01 D Cruz-Uribe and C P´ rez, “Two-weight, weak-type norm inequalities for fractional integrals, e Calderon-Zygmund operators and ... commutators,” Indiana University Mathematics Journal, vol 49, no ´ 2, pp 697– 721 , 20 00 14 Journal of Inequalities and Applications J Garc a- Cuerva and J M Martell, “Two-weight norm inequalities...

Ngày tải lên: 21/06/2014, 17:20

14 275 0
Báo cáo hóa học: " Fast Watermarking of MPEG-1/2 Streams Using Compressed-Domain Perceptual Embedding and a Generalized Correlator Detector" docx

Báo cáo hóa học: " Fast Watermarking of MPEG-1/2 Streams Using Compressed-Domain Perceptual Embedding and a Generalized Correlator Detector" docx

... Figure 2: Watermark generation Audio packets and packets containing interframe data are not altered The stream structure remains unaffected and only the video packets that contain coded I-frame data ... [23 ] [24 ] [25 ] [26 ] [27 ] [28 ] [29 ] [30] International Workshop on Digital and Computational Video, vol 1, pp 140–147, Tampa, Fla, USA, February 20 01 N Nikolaidis and I Pitas, “Robust image watermarking ... system streams are multiplexed streams that contain at least two elementary streams, that is, an audio and a video elementary stream A fast and efficient video watermarking system should be able to...

Ngày tải lên: 23/06/2014, 01:20

19 242 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx

MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx

... Prokop, Walid Hassairi, Moncef Bousselmi, Mohamed Abid, Carlos Valderrama, Moulay Tahar Lamchich, Nora Lachguer, Gaizka Almandoz, Gaizka Ugalde, Javier Poza, Ana Julia Escalada, Oriol Font-Bach, Antonio ... DVB-S2 Model in Matlab: Issues and Impairments 21 7 Bahman Azarbad and Aduwati Binti Sali Chapter 11 Wireless Channel Model with Markov Chains Using MATLAB 23 5 Diana Alejandra Sánchez-Salas, José ... Software for Design and Analysis of Electrical Machines 161 Gaizka Almandoz, Gaizka Ugalde, Javier Poza and Ana Julia Escalada Section Telecommunication-Communication Systems 185 Chapter MATLAB as...

Ngày tải lên: 29/06/2014, 09:20

324 788 0
A textbook of Computer Based Numerical and Statiscal Techniques part 2 ppsx

A textbook of Computer Based Numerical and Statiscal Techniques part 2 ppsx

... numerical answer can be obtained even when a problem has no analytical solution However, result from numerical analysis is an approximation, in general, which can be made as accurate as desired ... is a nonterminating decimal fraction For using such a number in practical computation, it is to COMPUTER BASED NUMERICAL AND STATISTICAL TECHNIQUES be cut-off to a manageable size such as 0 .29 , ... + 2  1 2 X ∂ X ∂ X δ x + . + (δx1 ) + (δx2 ) + + (δxn ) + 2 x1δx2  2 ∂x1∂x2 ∂x1 ∂x2 δxn  Errors δx1, δx2, ., δxn all are small so that the terms containing (δx1 )2, (δx2 )2, (δxn )2 and...

Ngày tải lên: 04/07/2014, 15:20

10 337 1
w