... three different heads: fabric, trims and accessories and packaging material [1] Inward Material Quality: This parameter shall evaluate the adherence of quality standards of material received from ... on a scale of 1-10 based on their importance Of total 15 responses average weight was calculated and listed against each KPI Overall supply chain performance for organisation ABC (Weightage average ... 8.8 Data not available to measure Cost Adherence Planned T &A v/s Actual T &A Data not available to measure 70.86 5.73 47.78 Measured based on planned cut date schedule 8.13 Make Capacity Utilization...
Ngày tải lên: 31/03/2014, 03:20
... JIT-I and organisational performance is significant at the 0.01 level with a standardised estimate of 0.26 and an associated t-value of 3.10 As theorised, a supply chain management strategy is antecedent ... technology as the ‘crux of modern supply chain management’ Firms that adopt a supply chain management strategy must, therefore, necessarily develop enabling information systems H1: A supply chain management ... published papers in International Journal of Production Research, International Journal of Human Resource Management, Journal of Business and Industrial Marketing, Supply Chain Management: An International...
Ngày tải lên: 28/05/2014, 20:34
Designing a supply chain Proposition for improving quality and overall productivity of enterprises using business model
... three categories: • Lean supply chain • Agile supply chain • Hybrid supply chain 31 2.9.1 Lean supply chains Lean supply chains adopt lean manufacturing and emphasis on reduction of wastes across ... collaborative • Coordination of information sharing: Partially or fully shared 2.8 SUPPLY CHAIN PERFORMANCE MEASURES Assessing the supply chains performance periodically is as vital as managing ... efficient supply chains strategy and later requires responsive supply chains Another important aspect of the supply chains is the performance measures: Qualitative and Quantitative (Beamon, 1998)...
Ngày tải lên: 01/06/2014, 13:59
Tài liệu ANATOMY OF A ROBOT pdf
... that making the actuator gain as large as possible is desireable Just be aware that increasing the gain of the actuator adds expense and will adversely affect the dynamic (nonsteady state) behavior ... has a control mechanism for refilling the tank with the appropriate amount of water, and reliability is paramount The average toaster is great at browning bread in a repeatable manner You can ... selection and design of robotic software The chapter outlines a coordinated approach to the selection of a processor, a battery, a power supply, operating software, and application software Included are...
Ngày tải lên: 19/01/2014, 19:20
Tài liệu Anatomy of a Robot P2 pdf
... that making the actuator gain as large as possible is desireable Just be aware that increasing the gain of the actuator adds expense and will adversely affect the dynamic (nonsteady state) behavior ... has a control mechanism for refilling the tank with the appropriate amount of water, and reliability is paramount The average toaster is great at browning bread in a repeatable manner You can ... that it cannot be zero; a steady state error always exists Note also that the larger the gain, C, of the actuator, the smaller the steady state error As C tends toward infinity, the steady state...
Ngày tải lên: 19/01/2014, 20:20
Tài liệu Anatomy of a Robot P1 ppt
... selection and design of robotic software The chapter outlines a coordinated approach to the selection of a processor, a battery, a power supply, operating software, and application software Included are ... unacquainted with the project The plan’s schedule can be drawn up using a standard software package (such as Microsoft Project) in a Gantt bar chart format (about 10 to 20 bars) A portion of ... intervals The plan should also have a title page, an introduction, and a couple of lines explaining each task shown on the bar chart The plan should also include a page or two explaining the approach...
Ngày tải lên: 19/01/2014, 20:20
Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt
... created maps containing as many as 518 million of these hyperlinks, a significant sample of the total These maps allow rapid calculation of a web page’s "PageRank", an objective measure of its citation ... PageRank, again see [Page 98] Another intuitive justification is that a page can have a high PageRank if there are many pages that point to it, or if there are some pages that point to it and have ... DARPA and NASA, and by Interval Research, and the industrial partners of the Stanford Digital Libraries Project References Best of the Web 1994 Navigators http://botw.org/1994/awards/navigators.html...
Ngày tải lên: 24/01/2014, 20:20
Anatomy of a Health Scare: Education, Income and the MMR Controversy in the UK doc
... thousand babies, and the average age among adults living in the area (as a proxy for the demand for health care).16 The first column of Table shows the mean across all areas and years and the standard ... The average number of babies in an area-year cell is 6,106 with a standard deviation of 2,629 Most of this variation is due to area-size differences: the standard deviation in number of babies across ... increase of about percentage points in the last two years of data portion of lone parents, number of GPs, and average age of adults, has not been uniform across areas 19 The second specification adds...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
Research " MANAGING SUPPLY CONTRACTS AND INVENTORY RISKS IN A SUPPLY CHAIN " pptx
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx
... COQ1 -a COQ1-b dps1 -a dps1-b Description (5¢- to 3¢) CCGGATCCCATGTTTCAAAGGTCTGGC GCCCCCGGGTTACTTTCTTCTTGTTAGTA TAC CCGGATCCATGTTTCAAAGGTCTGGC CGAATTCTTACTTTCTTCTTGT CAGTGAATTCGAGCTCGGTACCC ATACATACTGAATCATCATCTCCTTC ... Okada K, Kamiya Y, Zhu X, Tanaka K, Nakagawa T, Kawamukai M & Matsuda H (1997) Analysis of the decaprenyl diphosphate synthase (dps) gene in fission yeast suggests a role of ubiquinone as an antioxidant ... Arabidopsis thaliana Plant Mol Biol 55, 567–577 14 Saiki R, Nagata A, Kainou T, Matsuda H & Kawamukai M (2005) Characterization of solanesyl and decaprenyl diphosphate synthases in mice and humans FEBS...
Ngày tải lên: 30/03/2014, 04:20
the broadband problem anatomy of a market failure and a policy dilemma
... superhuman, efforts of my assistants, administrative, technological, and academic: Simone Ross, Shoshana Haulley, Isabelle Mussard, Dave Irvine, John Castro, and Audrey Marrs They found facts, articles, ... Litan, Strobe Talbott, Michael Armacost before him, and Chris Kelaher and all the people at Brookings Institution Press And finally, I must thank the staffs of Balthazar in New York and of the cafés ... others—raised large amounts of capital regardless of the sustainability of their business, technical, and competitive plans These plans were in fact not sustainable, in part due to the resistance of...
Ngày tải lên: 03/06/2014, 00:55
ANATOMY OF A ROBOT CHARLES M. BERGREN ppt
... that making the actuator gain as large as possible is desireable Just be aware that increasing the gain of the actuator adds expense and will adversely affect the dynamic (nonsteady state) behavior ... has a control mechanism for refilling the tank with the appropriate amount of water, and reliability is paramount The average toaster is great at browning bread in a repeatable manner You can ... selection and design of robotic software The chapter outlines a coordinated approach to the selection of a processor, a battery, a power supply, operating software, and application software Included are...
Ngày tải lên: 27/06/2014, 18:20
Báo cáo nông nghiệp: "Safe vegetables in Hanoi, a supply chain perspective analysis" potx
... Oliver and Weber in 1982: Management of materials flow across organizational borders Tan et al (1998) also defined: SCM encompasses materials /supply management from the supply of basic raw materials ... leaders found in vegetable supply chain in Hanoi area The chain was established and operated automatically Each stakeholder maximized their own benefits and did not care about the benefits of ... Supply chain of safe vegetable in Hanoi has established spontaneously and operated inefficiently The cooperation between and among stakeholders of the chains is every weak Each stakeholder of the chain...
Ngày tải lên: 07/08/2014, 02:21
Anatomy of a Robot Part 1 ppsx
... selection and design of robotic software The chapter outlines a coordinated approach to the selection of a processor, a battery, a power supply, operating software, and application software Included are ... version of this title: 0-07-141657-9 All trademarks are trademarks of their respective owners Rather than put a trademark symbol after every occurrence of a trademarked name, we use names in an editorial ... for you Each major discipline is the subject of a separate chapter Each chapter will cover the basics but will also lead you to theory and reasoning that can capture the imagination For each discipline,...
Ngày tải lên: 10/08/2014, 01:22
Anatomy of a Robot Part 2 pptx
... has a control mechanism for refilling the tank with the appropriate amount of water, and reliability is paramount The average toaster is great at browning bread in a repeatable manner You can ... course of action for many reasons and management should encourage it That said, let’s assume you are the newly appointed PM of a new project Please realize you have a large vertical management ... Preliminary layout and plans for the board fabrication I Compliance issues Software considerations: I Block diagram of major software modules I Performance estimates I Major algorithms I Interfaces...
Ngày tải lên: 10/08/2014, 01:22
Anatomy of a Robot Part 4 pps
... PARAMETERS We have already seen that altering v and d can substantially change the performance of the robot Further, altering these parameters offers a reliable way to change just one type of ... posed earlier 64 CHAPTER TWO HOW MANY VARIABLES CAN BE CONTROLLED AT THE SAME TIME? Practically speaking, the LMS algorithm can handle an arbitrary number of simultaneous variables However, as the ... the case of an actuator or sensors that are either off or on These are familiar to you already: I Thermostats The furnace in most houses cannot be operated halfway The burners not have a medium...
Ngày tải lên: 10/08/2014, 01:22
Anatomy of a Robot Part 5 ppt
... companies have probably written software that takes advantage of the special features of the computer We can purchase this software and use it in various ways: I Freeware Often an author of software ... star in any direction (360 degrees), gravitational lenses often provide an image of a star as a ring or arc of light Some nice examples of gravitational lenses can be found at www.iam.ubc.ca/ϳnewbury/lenses/glgallery.html ... star was being bent around an intervening star, so both images appeared to us on Earth This was another manifestation of gravity bending light and has been called a gravitational lens Since starlight...
Ngày tải lên: 10/08/2014, 01:22
Anatomy of a Robot Part 6 pot
... a boot program will always exist and will not change The boot program can download and burn program flash That way, we have a minimal chance of corrupting the program to the extent that we have ... this by taking advantage of some of the capacitance under the transistor A capacitor is basically a place to store electrons The number of electrons in the capacitor determines whether a binary one ... simplification First of all, cache memory usually has just a few thousand words Each of these words can contain both a full memory data word (duplicating the contents of a DRAM memory address) and...
Ngày tải lên: 10/08/2014, 01:22
Anatomy of a Robot Part 7 doc
... Generally, the signals that are recorded are more than sufficient to allow a proper read of the data I Bad disk surface HDs also have a mechanism to avoid bad spots on the disk surface A separate ... are I Removable media may be less reliable than permanent media I Removable media can be stolen or misplaced I Removable media can jar loose with shock I Removable media drives leave an extra ... will only address magnetic HD disks An HD is basically a spinning disk of magnetic material that can contain bits on its surface A read/write head glides over the surface and provides access to...
Ngày tải lên: 10/08/2014, 01:22