anatomy of a prospective payment system

... subcontract from RAND to Harvard University and represents a collaborative effort involving faculty from the department of Health Care Policy at Harvard Medical School, Sargent College of Health and ... and Rehabilitation Sciences at Boston University and RAND Health Library of Congress Cataloging-in-Publication Data Final report on assessment instruments for prospective payment system : appendices ... publications not necessarily reflect the opinions of its research clients and sponsors R® is a registered trademark A profile of RAND Health, abstracts of its publications, and ordering information...

Ngày tải lên: 07/03/2014, 05:20

... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager_data_lock call), the kernel issues a pager_data_unlock call The data manager is ... memory as a cache of secondary storage data pages The effect of this kind of caching on the performance of UNIX and its traditional suite of application programs is dramatic Compilation of a small...

Ngày tải lên: 12/09/2012, 15:05

... that making the actuator gain as large as possible is desireable Just be aware that increasing the gain of the actuator adds expense and will adversely affect the dynamic (nonsteady state) behavior ... has a control mechanism for refilling the tank with the appropriate amount of water, and reliability is paramount The average toaster is great at browning bread in a repeatable manner You can ... unacquainted with the project The plan’s schedule can be drawn up using a standard software package (such as Microsoft Project) in a Gantt bar chart format (about 10 to 20 bars) A portion of...

Ngày tải lên: 19/01/2014, 19:20

... that making the actuator gain as large as possible is desireable Just be aware that increasing the gain of the actuator adds expense and will adversely affect the dynamic (nonsteady state) behavior ... has a control mechanism for refilling the tank with the appropriate amount of water, and reliability is paramount The average toaster is great at browning bread in a repeatable manner You can ... behavior of the control system as we will see later In the worst case, a large actuator gain can make the system unstable and lead to failures Whenever altering the gain, remember to reevaluate and...

Ngày tải lên: 19/01/2014, 20:20

... unacquainted with the project The plan’s schedule can be drawn up using a standard software package (such as Microsoft Project) in a Gantt bar chart format (about 10 to 20 bars) A portion of ... selection of a processor, a battery, a power supply, operating software, and application software Included are many software techniques that have proven successful, including a discussion of braking ... intervals The plan should also have a title page, an introduction, and a couple of lines explaining each task shown on the bar chart The plan should also include a page or two explaining the approach...

Ngày tải lên: 19/01/2014, 20:20

... justification is that a page can have a high PageRank if there are many pages that point to it, or if there are some pages that point to it and have a high PageRank Intuitively, pages that are well ... DARPA and NASA, and by Interval Research, and the industrial partners of the Stanford Digital Libraries Project References Best of the Web 1994 Navigators http://botw.org/1994/awards/navigators.html ... in an uproar, and OpenText has ceased to be a viable search engine But less blatant bias are likely to be tolerated by the market For example, a search engine could add a small factor to search...

Ngày tải lên: 24/01/2014, 20:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

... on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference on Very Large Databases(VWB), ... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... valueis created,or determinedautomatically by the system Catalog Management: Each E-ADT can provide catalogs that maintain statisticsand storeschemainformation Further, certain valuesmay be named Query...

Ngày tải lên: 16/03/2014, 16:20

... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to accommodate the ... infinitival phrases in place of deverbal nominal constructions Apart from this difference, the major textual characteristics carry over from source to target sublanguage thereby facilitating mechanical...

Ngày tải lên: 17/03/2014, 19:21

... thousand babies, and the average age among adults living in the area (as a proxy for the demand for health care).16 The first column of Table shows the mean across all areas and years and the standard ... The average number of babies in an area-year cell is 6,106 with a standard deviation of 2,629 Most of this variation is due to area-size differences: the standard deviation in number of babies across ... increase of about percentage points in the last two years of data portion of lone parents, number of GPs, and average age of adults, has not been uniform across areas 19 The second specification adds...

Ngày tải lên: 22/03/2014, 14:20

... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing 39...

Ngày tải lên: 23/03/2014, 14:20

... by an average of $250 a year McKinley Park, Sacramento PARK VALUE IN ACTION Promoting Human Health in Sacramento Sacramento has 5,141 acres of parks that provide a multitude of ways to stay healthy ... green space in parks First, land cover data are obtained through analysis of aerial photographs This reveals forested as well as open grassy areas and also water surface; it also reveals impervious ... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate...

Ngày tải lên: 02/04/2014, 08:20

... superhuman, efforts of my assistants, administrative, technological, and academic: Simone Ross, Shoshana Haulley, Isabelle Mussard, Dave Irvine, John Castro, and Audrey Marrs They found facts, articles, ... Litan, Strobe Talbott, Michael Armacost before him, and Chris Kelaher and all the people at Brookings Institution Press And finally, I must thank the staffs of Balthazar in New York and of the cafés ... others—raised large amounts of capital regardless of the sustainability of their business, technical, and competitive plans These plans were in fact not sustainable, in part due to the resistance of...

Ngày tải lên: 03/06/2014, 00:55

... include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient privacy) b) by observing patients' ability ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... committee of the American College of Physicians specifically supported the view that maintenance of a patient's functional well-being is a fundamental goal of medical practice They also noted that the...

Ngày tải lên: 18/06/2014, 19:20

... physiological measures, another epidemiological available approach is measuring rest/activity regulation with a validated assessment applicable in clinical settings as a part of a questionnaire measuring ... developed as an epidemiological, preventive health care and clinical measure in a long and short version, and has been validated, applied and evaluated against physical risk factors prospectively ... The aim of our study was to assess the influence on overall survival of 1) the validated autonomic regulation scale (aR) (and its subscale for rest/activity rhythm (R /A. aR)) [9] and of Page of...

Ngày tải lên: 20/06/2014, 15:20

... include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient privacy) b) by observing patients' ability ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... committee of the American College of Physicians specifically supported the view that maintenance of a patient's functional well-being is a fundamental goal of medical practice They also noted that the...

Ngày tải lên: 20/06/2014, 16:20

... other than u1 and u2, then the interior of 〚u1, u2〛 is either a subset of the basin of attraction of u1 or a subset of the basin of attraction of u2 Kalabušić et al Advances in Difference Equations ... subset of the basin of attraction of E All orbits that start below this curve are attracted to E1 All orbits that start above this curve are attracted to E (A1 − A2 − β1 + γ2 ) 4B2 R13 A1 = β1 , A1 ... global stable manifold W s(E3) that separates the positive quadrant so that all orbits below this manifold are attracted to the equilibrium point E1, and all orbits above this manifold are attracted...

Ngày tải lên: 21/06/2014, 00:20

... equations of parabolic type Translation of Mathematical Monographs American Mathematical Society, Providence 23 (1968) 15 Friedman, A: Partial Differential Equations of Parabolic Type Prentice-Hall ... Global and nonglobal weak solutions to a degenerate parabolic system J Math Anal Appl 324(1), 177–198 (2006) doi:10.1016/j.jmaa.2005.12.012 Okubo, A: Diffusion and Ecological Problems: Mathematical ... this article as: Zhang et al.: Local existence and uniqueness of solutions of a degenerate parabolic system Advances in Difference Equations 2011 2011:12 Submit your manuscript to a journal and...

Ngày tải lên: 21/06/2014, 03:20

... involves an active human role Natural enemies of insect pests, also known as biological control agents, include predators, parasites, and pathogens Virtually all pests have some natural enemies, and ... fundamental matrix Φ t and the constant matrix M which we call the monodromy matrix of 2.5 corresponding to the fundamental matrix of Φ t All monodromy matrices of 2.5 are similar and have the ... perturbations have been illustrated to substantiate our mathematical results and to show that the system we have considered in this paper gives birth to various kinds of dynamical behaviors Actually,...

Ngày tải lên: 21/06/2014, 07:20

... 1983 24 O Ladyzenskaja, V Solonnikov, and N Uraltseva, “Linear and quasilinear equations of parabolic type,” in Translations of Mathematical Monographs, vol 23, American Mathematical Society, ... “Global existence and blow-up for a nonlinear reaction-diffusion system, ” Journal of Mathematical Analysis and Applications, vol 212, no 2, pp 481–492, 1997 Journal of Inequalities and Applications ... Theory, Methods & Applications, vol 60, no 5, pp 977–991, 2005 19 V A Galaktionov, S P Kurdyumov, and A A Samarski˘, A parabolic system of quasilinear ı equations I,” Differential Equations, vol 19,...

Ngày tải lên: 21/06/2014, 07:20