... modeled. Table S4. Average rmsd (A ˚ ) for the conserved catalytic residues calculated from MD simulations of a- CT and the various Lac -a- CT conjugates modeled. This material is available as part of the ... mechanism of the enzyme. Structural insights into the mechanochemical nature of a- CT catalysis A more detailed analysis of the influence of chemical glycosylation on the dynamics of a- CT from the ... quantitative analysis of the HX decay data was done by a two-exponential model: X ẳ A 1 exp k HX;1 ịt ỵ A 2 exp k HX;2 ịt ỵ A 3 where A 1 , A 2 , and A 3 are the fractions of the fast, slow and stable...
Ngày tải lên: 19/02/2014, 05:20
... of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan. Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... part of South-East Asia and occupies a total land area of 330,434 square kilometres. The land mass comprises three main components: Peninsular Malaysia and the two states of Sabah and Sarawak, ... tidal stream of over 4 knots. The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges from a...
Ngày tải lên: 06/03/2014, 15:21
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
... reliable estimates for the kinetic parameters of autocatalytic reaction. The problem of non-uniqueness of the estimated parameters can b e solved by a global analysis approach when a series of ... these contributions did not include the autoactivation of zymogens, which is a particular case of the activation of zymogens. As the autocatalytic activation of zymogens plays a key role in the ... regulation of many integrated metabolic systems in living organisms, a detailed kinetic analysis for the autocatalytic zymogen activation reaction is desired. The a utocatalytic activation of zymogens in...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... S RNA of TULV. GGAAAUG GCCAAGU G-C A- U G-C A- U U -A G G U -A G:U C A- U U -A 337 381 (+) sense U:G U -A C U C-G U -A C-G U -A C-G U -A A-U C C A- U C A G U -A A-U (-) sense A C A- U G A G-C A- U CCUUUAC ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855). To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Hairpin-like ... 206:973-983. 18. Vapalahti O, Lundkvist Å, Kukkonen SKJ, Cheng Y, Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus:...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... S RNA of TULV. GGAAAUG GCCAAGU G-C A- U G-C A- U U -A G G U -A G:U C A- U U -A 337 381 (+) sense U:G U -A C U C-G U -A C-G U -A C-G U -A A-U C C A- U C A G U -A A-U (-) sense A C A- U G A G-C A- U CCUUUAC ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855). To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Hairpin-like ... carried out the experiments and helped to draft the manuscript. AlexP participated in the design of the study and drafted the manuscript. Both authors read and approved the final manuscript. Acknowledgements The...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" The biomechanical analysis of three plating fixation systems for periprosthetic femoral fracture near the tip of a total hip arthroplasty" docx
... Michael's Hospital, 30 Bond Street, Toronto, ON, M5B-1W8, Canada Full list of author information is available at the end of the article Lever et al. Journal of Orthopaedic Surgery and Research ... cable-plate systems where the method of cable capture by the plate varied between the repair systems. Furthermore, these studies have lim- ited their mechanical tests to standard axial, lateral, ... near the tip of a total hip arthroplasty James P Lever 1 , Rad Zdero* 2,3 , Markku T Nousiainen 2 , James P Waddell 4 and Emil H Schemitsch 5 Abstract Background: A variety of techniques are available...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf
... in terms of the amount of charge (Q) stored at a given voltage drop (across the capacitor)) of a capacitor is given by (1). (Note that: the SI unit of capacitance is the farad; 1 farad = 1 coulomb ... supply a constant voltage. The EE can power the target system via its battery interface with a variable voltage supply. The EE has all the advantages, except for EnergyBucket’s hardware annotation of ... implement an API, so any existing application can be evaluated. We have evaluated a retail application but it is possible and desirable to evaluate other application domains like agricultural machinery,...
Ngày tải lên: 21/06/2014, 11:20
ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx
... of taking of the normal component of a trace on the boundary of a function defined on Ω 0 .Theoperatorγ n 220 On weak solutions of the equations of motion Proof. Integration by parts and use of ... the space CG. For the proof of Lemma 5.6 it is enough to repeat the proof of Lemma 3.2 in [21]and take advantage of Lemma 5.6 and (2.5). Lemma 5.8. For any z ∈ CG and u,v ∈ E the estimates hold: C(v,z) ... Zvyagin: Department of Algebra and Topological Methods of Analysis, Faculty of Mathemat- ics, Voronezh State University, Universitetskaya pl. 1, 394006 Voronezh, Russia E-mail address: zvg@main.vsu.ru V....
Ngày tải lên: 23/06/2014, 00:20
Báo cáo khoa học: "Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings" ppsx
... suggested that the shape and the spatial extension of root systems markedly influence the rate and patterns of nutrient uptake from the soil. Many nutrient and water uptake models have ... Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings M. Colin-Belgrand 1 L. Pages 2 E. ... tip (Hackett, 1971 ). In the same way, effects of water stress on lateral root initiation and elongation have been reported (Jupp and Newman, 1987). An analogous effect of waterlogging...
Ngày tải lên: 09/08/2014, 02:21
Comparative genome and phenotypic analysis of Clostridium difficile 027 strains provides insight into the evolution of a hypervirulent bacterium" ppsx
... MIC assays, MM performed PCR analysis, and DNG provided strains and critical analysis. RAS, LD, JP, MH and BWW drafted the manuscript. All authors contributed to and approved the final manuscript. Additional ... manuscript. Additional data files The following additional data are available with the online version of this paper: CDSs specific to PCR-ribotype 027 iso- lates (Additional data file 1); CDSs that have ... top 2 to 5 mm of BHI agar in the glass vial. These were then left overnight in the anaerobe chamber; the vials were then removed from the anaerobe chamber and photographed to record the motility. Minimum...
Ngày tải lên: 09/08/2014, 20:20
báo cáo khoa học: " Individual and setting level predictors of the implementation of a skin cancer prevention program: a multilevel analysis" docx
Ngày tải lên: 10/08/2014, 10:22
báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx
Ngày tải lên: 11/08/2014, 23:22
Báo cáo khoa học: " In vitro analysis of expression vectors for DNA vaccination of horses: the effect of a Kozak sequence" docx
Ngày tải lên: 12/08/2014, 18:22
Nonlinear vibration of a pendulum with a support in harmonic motion
Ngày tải lên: 08/04/2015, 15:30
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... prevent. ã Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. While this is an advantage for shared memory applications, it is a serious ... temporarily allow read-only access to cached data. The locking on a page may later be changed as deemed necessary by the data manager. [To avoid race conditions, the pager_data_provided call also ... to the default pager is identical to other external data managers, there are no fundamental assumptions made about the nature of secondary storage. For example, the default pager may use local...
Ngày tải lên: 12/09/2012, 15:05