analysis of macbeths soliloquy act 1 scene 3
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... 4 E 132 A 51 ± 9 30 ± 1* R 133 A 90 ± 10 57 ± 2 R 135 A 57 ± 6 26 ± 2* F 136 A 88 ± 12 67 ± 5 I 137 A 18 ± 2 < ;10 and 17 0 ± 10 * a I 138 A 52 ± 4 78 ± 4* N 139 A 7 ± 1 33 5 ± 214 * D140A 63 ± 2 17 ± 0* W141A ... 13 63 ± 6 M149K 83 ± 11 13 6 ± 24* N152D 99 ± 8 67 ± 3 G155P, K156S, G157E 75 ± 16 50 ± 2* N152D, G155P, K156S, G157E 83 ± 12 67 ± 6 G155K, D (15 6 15 7), A158E 66 ± 12 73 ± 6* M149K, G155K, D (15 6 15 7), ... 4 31 ± 15 8* V142A 32 ± 4 7 ± 2 and 12 0 ± 5* a K143A 88 ± 6 48 ± 3* T144A 77 ± 13 47 ± 6* H145A 75 ± 3 61 ± 7 T146A 7 ± 1 217 ± 33 * K147A 87 ± 12 26 ± 6* M149A 10 ± 6 18 ± 2* N152A 13 ± 2 17 ± 3...
Ngày tải lên: 20/02/2014, 11:20
Numerical analysis of externally prestressed concrete beams part 1
... ⎥ ⎦ ⎤ + ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ −+−−+ ⎢ ⎢ ⎣ ⎡ + ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ +− ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ +−+−− ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ + + = 3 2 2 32 3 3 2 23 3 2 2 33 2 2 3 3 2 232 2 11 66 , 2 31 2 , 16 212 12 1, 2 31 2 12 1 12 1 1 x L x L L K x L K x L x L x L K x L x L K L x L K L K x L x L x L K L K L K N vy (3 .15 ) ⎥ ⎦ ⎤ ⎢ ⎣ ⎡ −= L x L x N u ,1 ... [] {} dK u u K KKSym KKK KKKK KKKKK KKKKKK M Q P M Q P c c cc ccc cccc ccccc cccccc = ⎪ ⎪ ⎪ ⎪ ⎭ ⎪ ⎪ ⎪ ⎪ ⎬ ⎫ ⎪ ⎪ ⎪ ⎪ ⎩ ⎪ ⎪ ⎪ ⎪ ⎨ ⎧ ⎥ ⎥ ⎥ ⎥ ⎥ ⎥ ⎥ ⎥ ⎦ ⎤ ⎢ ⎢ ⎢ ⎢ ⎢ ⎢ ⎢ ⎢ ⎣ ⎡ = ⎪ ⎪ ⎪ ⎪ ⎭ ⎪ ⎪ ⎪ ⎪ ⎬ ⎫ ⎪ ⎪ ⎪ ⎪ ⎩ ⎪ ⎪ ⎪ ⎪ ⎨ ⎧ 2 2 2 1 1 1 66 5655 464544 36 3 534 33 262524 232 2 16 1 514 1 31 2 11 2 2 2 1 1 1 θ ν θ ν (3. 24) Every element of matrix [ K c ] can be defined as below equations: ))(( 11 11 2 11 jjkk M j N k i jkjk c rrqq L Eb K ... therefore in urgent -36 - [] [] {} e uu e u dNd L x L x u = ⎥ ⎦ ⎤ ⎢ ⎣ ⎡ −= 1 where 3 2 2 33 2 3 3 2 22 3 2 2 33 3 2 3 3 2 22 2 11 6 212 , 236 , 1 6 212 1 124 , 236 1 12 1 1 x L x L L K L K L K x L x LL K x L x L K L x L K L K L K x L x LL K L K N vb + ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ −+ ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ −−++ ⎢ ⎢ ⎣ ⎡ ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ +− ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ ++ ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ +−+− ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ + + = ...
Ngày tải lên: 07/11/2012, 11:04
A contrastive analysis of encouraging as a speech act in english and vietnamese
Ngày tải lên: 26/11/2013, 13:31
Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt
... httEx1-25Q-EGFP vector, 25Q AC B 10 0 04080 Counts 12 0 16 0 200 10 1 10 2 FL2-H 10 3 10 4 25Q +NAC 72Q 72Q+NAC 10 3Q 10 3Q+NAC 04080 Counts 12 0 16 0 200 10 0 10 1 10 2 FL2-H 10 3 10 4 10 0 10 1 10 2 FL2-H 10 3 10 4 04080 Counts 12 0 ... increase of reactive oxygen species caused by huntingtin. Hum Mol Genet 11 , 11 37 11 51. Huntingtin inclusions and oxidation W. J. J. Firdaus et al. 30 90 FEBS Journal 2 73 (2006) 30 7 630 93 ê 2006 ... arrigo@univ-lyon1.fr (Received 16 February 2006, revised 20 April 2006, accepted 12 May 2006) doi :10 .11 11/ j .17 42-4658.2006.05 31 8 .x We recently reported that the transient expression of polyglutamine tracts of...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Fluorescence analysis of the Hansenula polymorpha peroxisomal targeting signal-1 receptor, Pex5p pdf
... L1 HpPex5p + L2 HpPex5p HpPex5p + L1 HpPex5p + L2 hsi, ns 1. 78 ± 0.04 a 1. 40 ± 0.02 1. 31 ± 0. 03 1. 43 ± 0.08 1. 31 ± 0.04 1. 25 ± 0.05 b 1 0. 035 ± 0.004 0.042 ± 0.008 0.0 31 ± 0.007 0.0 41 ± 0. 011 ... 0.006 / 1 , ns 0 .33 ± 0.08 0.55 ± 0 . 13 0.42 ± 0 .14 0.50 ± 0 .14 0. 63 ± 0 .34 0. 53 ± 0. 21 / 2 , ns 2.50 ± 0. 21 3. 48 ± 0.80 2 .32 ± 0.26 1. 92 ± 0.44 2 . 13 ± 0.85 2.46 ± 0.62 / 3 , ns 30 0 b 30 0 b 30 0 b 57 ... 0. 033 ± 0. 012 0. 033 ± 0. 012 b 2 0.089 ± 0.004 0.089 ± 0.006 0.088 ± 0.007 0.062 ± 0.008 0.058 ± 0.0 21 0.070 ± 0. 010 b 3 0 . 13 6 ± 0.002 0 .12 4 ± 0.0 01 0 . 13 7 ± 0.002 0 .15 3 ± 0.006 0 .15 4 ± 0.005 0 .14 5...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx
... 1. 8 13 1. 678 1. 645 1. 645 3 .16 0 3 .16 0 Pro12 4.295 2.270 1. 990 1. 990 1. 879 3. 705 3. 5 91 CONH 7.788 CONH 7. 017 NHCH 31 2 34 56a6b GalNAc 7.8 03 1. 975 4.775 4. 016 3. 850 3. 914 3. 972 3. 715 3. 6 91 1446 H. Mo ă ller ... of protons marked by – were not visible. NH abb cc dd Pro8 4 .34 7 2 .39 7 1. 9 83 1. 9 83 1. 9 83 3 .36 8 3. 31 7 Asp9 – 4.779 2.747 2.558 Thr10 8. 914 4.445 4.297 1. 217 Arg 11 8. 510 4.504 1. 8 13 1. 678 1. 645 ... s of protons marked by were not visible. NH abb cc dd Pro8 4 .34 7 2 .38 9 1. 978 1. 978 1. 978 3. 336 3. 336 Asp9 4.666 2.707 2.5 43 Thr10 8 .38 6 4.252 4 .15 5 1. 134 Arg 11 8.484 4.574 1. 798 1. 724 1. 629...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot
... Allergy 27, 13 07 13 13. 19 Wu W, Tam MH, Peng HJ, Tsai LC, Chi CW & Chang ZN (20 01) Isolation and partial characterization of a 46-kD allergen of Bermuda grass pollen. J Biomed Sci 8, 34 2 34 8. 20 ... Chow LP & Huang SW (20 03) Purification and characterization of a novel isoallergen of a major Bermuda grass pollen aller- gen, Cyn d 1. J Biomed Sci 10 , 11 1 11 9. 10 Su SN, Lau GX, Yang SY, ... Singh MB (19 96) Cloning and expression in yeast Pichia pastoris of a biologically active form of Cyn d 1, the major allergen of Bermuda grass pollen. J Allergy Clin Immunol 98, 3 31 34 3. 9 Su SN,...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Functional analysis of the aglycone-binding site of the maize b-glucosidase Zm-p60.1 pot
... 2. 43 ± 0.05 0.69 ± 0.046 1. 09 1. 510 ± 0 .10 1 1. 87 ± 0.05 1. 24 ± 0.089 0 .34 W373K 2 .10 ± 0. 21 0. 63 ± 0.02 0 .30 ± 0. 032 0.48 1. 736 ± 0 .12 5 0.22 ± 0. 01 0 . 13 ± 0. 011 0.04 F461L 0.65 ± 0.05 49.27 ± 1. 15 ... 0. 03 42.80 ± 0.56 62.94 ± 2.89 10 0.00 0 .14 8 ± 0. 0 13 53. 60 ± 1. 09 36 2 .16 ± 32 .59 10 0.00 F193A 0.045 ± 0.0 035 0.22 ± 0.0 03 4.89 ± 0 .39 7.77 0 .12 0 ± 0. 012 1. 29 ± 0.04 10 .75 ± 1. 13 2.97 F200K 3. 50 ... 49.27 ± 1. 15 75.80 ± 6.09 12 0. 43 0 .16 4 ± 0. 019 70.88 ± 2 .16 432 .19 ± 51. 75 11 9 .34 Analysis of a b-glucosidase aglycone-binding site R. Dopitova ´ et al. 612 8 FEBS Journal 275 (2008) 612 3 6 13 5 ê 2008...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Analysis of the regulatory motifs in eukaryotic initiation factor 4E-binding protein 1 pot
... Sequence Residue numbers S6K1 FDIDL 5–9 a S6K2 FDLDL 5–9 a 4E-BP1 FEMDI 11 4 11 8 4E-BP2 FEMDI 11 6 12 0 4E-BP3 FEMDI 86–90 HIF1a FVMVL 99 10 3 PRAS40 FVMDE 12 9 13 3 PKCd FVMEF 425–429 PKCe FVMEY 484–488 STAT3 FPMEL FDMDL 26 30 756–760 a Numbering ... 17 amino acids [compare the signal for full-length 4E-BP1 (1 11 7) with that for the 18 11 7’ variant] and sections of the C-terminal half of 4E-BP1 [compare, for exam- ple, the 4E-BP1 (98 11 7) ... http://www.biochem.ubc.ca/ fac_research/faculty/proud.html (Received 10 December 2007, revised 22 February 2008, accepted 3 March 2008) doi :10 .11 11/ j .17 42-4658.2008.0 637 2.x Mammalian target of rapamycin complex 1 (mTORC1) phosphorylates proteins...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx
... – – cHx ETB 13 2 M 132 –S4 43 38.6 – – ⁄ xxxxxxxx xxxx cHx ETB 204 A204–S4 43 30.8 – – – – – – ⁄ xxxxxxxx cHx ETB 30 7 M307–S4 43 18 .8 – – – – – – – – – – ⁄ x x x x cHx ETB 93 P 93 V2 03 15 .3 ⁄ xxxxx ⁄ ... x x x Strep ETB 13 1 E27–C1 31 14.4 x x ⁄ –––––––––––– cHx ETB 16 8 E27–P168 18 .5 x x x x ⁄ –– –––––––– cHx ETB 2 03 E27–V2 03 22.2 x x x x x x ⁄ –––––––– cHx ETB 30 6 E27–G306 34 .1 x x x x x x x x ... fragments. Nine microliters of each sample was analyzed on a 16 .5% SDS gel. 1, ETB 93 ; 2, ETB 13 1 ; 3, ETB 16 8 ;4, ETB 2 03 , 5, ETB 30 6 ; 6, ETB 13 2 ; 7, ETB 204 ; 8, ETB 30 7 ; 9, ETB cHx . Arrows...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx
... that like the Trp residue of the 0.00 0.05 0 .10 0 .15 1. 0 1. 1 1. 2 1. 3 [acrylamide] M F 0 /F Fig. 3. Quenching of Trp fluorescence of Ag-NPA -1 by acrylamide. A value of 1. 3 M )1 was calculated for the ... 10 3 M )1 ặcm )1 for Ag-NPA -1) and the dye absorbances at 33 7 nm for IAEDANS (e M ,33 7 6 Ã 10 3 M )1 ặcm )1 ) and at 472 nm for IANBD (e M,472 23 Ã 10 3 M )1 ặcm )1 ). The covalent attach- ment of the dyes was ... 2004, accepted 20 September 2004) doi :10 .11 11/ j .14 32 -10 33 .2004.0 439 8.x Ag-NPA -1 (AgFABP), a 15 kDa lipid binding protein (LBP) from Ascari- dia galli, is a member of the nematode polyprotein allergen/antigen...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc
... extract 85 .3 3696 0.0 23 1 100 Ammonium sulfate ppt 87.4 516 0 .17 7 10 2 Phenyl Sepharose CL-4B 71. 9 76 0.95 41 84 BioScale DEAE10 36 .5 17 .4 2 .10 91 43 Table 3. Activity of Qor in crude extracts of ... (Uặmg )1 ) Purication (-fold) Yield (%) Crude extract 31 2 30 45 0 .10 1 100 Ammonium sulfate ppt 2 71 416 0.65 6.4 87 Phenyl Sepharose CL-4B 299 78 3. 83 37.5 96 BioScale DEAE10 206 9 .3 22 .1 216 .7 66 15 72 ... 3 February 20 03, accepted 19 February 20 03) Eur. J. Biochem. 270, 15 67 15 77 (20 03) Ó FEBS 20 03 doi :10 .10 46/j .14 32 -10 33 .20 03. 035 26.x sulfhydryl-group of the one electron reduced complex [2,24]. When...
Ngày tải lên: 17/03/2014, 10:20
explain the role of a concept of the american dream plays in act 1 of millers death of a salesman
Ngày tải lên: 21/03/2014, 22:01
ADVANCES IN QUANTITETIVE ANALYSIS OF FINANCE AND ACCOUNTING Volume 1 pdf
... 0.000000 0 .16 6667 0.666667 0 .16 6667 n = 5 0. 0 13 33 3 0. 2 13 33 4 0.546666 0. 2 13 33 4 0. 0 13 33 3 n = 6 0.0 03 31 6 0.0 811 93 0. 415 492 0. 415 492 0.0 811 93 0.0 03 31 6 n = 7 0.000802 0.026 810 0. 233 8 13 0.47 715 0 0. 233 8 13 0.026 810 ... 0.026 810 0.000802 [W ]w1w2w3w4w5w6w7 n=2 1. 000000 1. 000000 n =3 1. 732 0 51 0.000000 1. 732 0 51 n=4 3. 46 410 2 1. 732 0 51 0.000000 1. 732 0 51 n=5 −2. 738 608 1. 36 930 4 0.000000 1. 36 930 4 2. 738 608 n=6 3 .18 90 31 ... 1. 36 930 4 0.000000 1. 36 930 4 2. 738 608 n=6 3 .18 90 31 1. 9 13 419 −0. 637 806 0. 637 806 1. 9 13 419 3 .18 90 31 n=7 3. 594559 −2 .39 637 3 1. 19 818 6 0.000000 1. 19 818 6 2 .39 637 3 3. 594559 The above table presents the risk-neutral...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Dual expression of mouse and rat VRL-1 in the dorsal root ganglion derived cell line F-11 and biochemical analysis of VRL-1 after heterologous expression pptx
... this work. (Received 17 July 20 03, revised 21 August 20 03, accepted 1 September 20 03) Eur. J. Biochem. 270, 4264–42 71 (20 03) Ó FEBS 20 03 doi :10 .10 46/j .14 32 -10 33 .20 03. 03 811 .x ... GenBank sequence AF12 911 3. Primers corresponding to nucleotides 33 0 35 3 and 2587–2 610 (rVRL -1_ F: 5Â-AT GACTTCAGCCTCCAGCCCCCCA -3 and rVRL -1_ R: 5Â-GGGACTGGAGGACCTGAAGGGGCA -3 , respect- ively) ... rat VRL -1 sequence (Acc. No. AF12 911 3) . rVRL - 13 4F: 5Â-CTGGAGACTTCCGATGGAGA -3 and rVRL -15 68R: 5Â-CATCCGCTCCATTCTCTACC -3 to obtain fragment A with 534 bp; rVRL -15 49F: 5Â-GGTAGAGAATGGAGCGGATG -3 and...
Ngày tải lên: 31/03/2014, 07:20