analysis of a food effect phase i clinical trial

Báo cáo hóa học: " Phase I clinical trial of the vaccination for the patients with metastatic melanoma using gp100derived epitope peptide " pot

Báo cáo hóa học: " Phase I clinical trial of the vaccination for the patients with metastatic melanoma using gp100derived epitope peptide " pot

... Immunohistochemical analysis of vitiligo Biopsy specimens of the area with vitiligo in P2 were stained with H&E to identify infiltrating cells This focus was a match for vitiligo To characterize ... conducted a phase I clinical trial to treat the HLA -A* 2402-positive patients with stage IV melanoma by vaccination with the gp100-in4 peptide In this study, we examined the safety of this treatment as ... http://www.translational-medicine.com/content/8/1/84 Figure Inhibition of the specific reactivity by mAb of HLAclass I and CD8 The specific reactivity of CD8+ T-cells was inhibited by mAb of HLA-class I and...

Ngày tải lên: 18/06/2014, 16:20

12 397 0
Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx

Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx

... immediate isolation and cryopreservation of PBMC at each participating clinical center and indeed, optimization of cryopreservation media and of thawing practices has improved recovery of immunological ... sections of the manuscript and editing EF assisted in the gathering and organization of shipping data RJF was instrumental in concept of study ARC assisted in the in vitro studies and data analysis ... immunological monitoring of vaccine-based immunotherapeutic clinical trials Arguably, it is optimal to assay a blood sample immediately and at the site where it is collected, as is done for most routine...

Ngày tải lên: 18/06/2014, 19:20

13 606 0
báo cáo hóa học:" High rate of loss to clinical follow up among African HIV-infected patients attending a London clinic: a retrospective analysis of a clinical cohort" ppt

báo cáo hóa học:" High rate of loss to clinical follow up among African HIV-infected patients attending a London clinic: a retrospective analysis of a clinical cohort" ppt

... 1997, was identified as the initial date for the selection of the study population as by this date, HAART was widely available, and we wished to avoid the potential bias of availability of HAART ... the AmFAR Observational Database American Foundation for AIDS Research Community-Based Clinical Trials Network Journal of Clinical Epidemiology 1998, 51:779-793 26 Arici C, Ripamonti D, Maggiolo ... serial CD4 cell count and viral load, HAART history and dates of all clinic visits, were obtained from the HIV clinic electronic database for all patients We compared the clinical characteristics...

Ngày tải lên: 20/06/2014, 08:20

10 359 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot

báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot

... first in vitro and in vivo characterization of panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation ... for panitumumab Conjugation and radiolabeling of panitumumab F(ab’)2 Panitumumab F(ab’)2 was conjugated with the bifunctional acyclic trans-cyclohexyl-diethylenetriamine-pentaacidic acid (CHX -A" -DTPA) ... Lonza (Walkersville, MD, USA) The cells were maintained in a 5% CO2 and 95% air-humidified incubator Radioimmunoassays The immunoreactivity of the panitumumab F(ab’)2 was evaluated in a competition...

Ngày tải lên: 21/06/2014, 02:20

15 452 0
Báo cáo y học: "Predicting hospital admission and discharge with symptom or function scores in patients with schizophrenia: pooled analysis of a clinical trial extension" doc

Báo cáo y học: "Predicting hospital admission and discharge with symptom or function scores in patients with schizophrenia: pooled analysis of a clinical trial extension" doc

... the statistical analysis Authors' contributions CMK contributed to design of the analysis, execution of the statistical analysis, interpretation of the data, and final approval of the manuscript ... analysis, execution of the statistical analysis, interpretation of the data, and final approval of the manuscript CC contributed to the design of the analysis, interpretation of the data, decision ... France and associated patient characteristics Psychiatr Serv 2007, 58:1427-1432 Janicak PG, Wu JH, Mal L: Hospitalization rates before and after initiation of paliperidone ER in patients with...

Ngày tải lên: 08/08/2014, 23:21

8 425 0
Báo cáo y học: "Onset of efficacy with acute long-acting injectable paliperidone palmitate treatment in markedly to severely ill patients with schizophrenia: post hoc analysis of a randomized, double-blind clinical trial" doc

Báo cáo y học: "Onset of efficacy with acute long-acting injectable paliperidone palmitate treatment in markedly to severely ill patients with schizophrenia: post hoc analysis of a randomized, double-blind clinical trial" doc

... Morosini PL, Magliano L, Brambilla L, Ugolini S, Pioli R: Development, reliability and acceptability of a new version of the DSM-IV Social and Occupational Functioning Assessment Scale (SOFAS) ... in paliperidone palmitate-treated subjects (≥10% in any treatment group) were headache, insomnia, schizophrenia exacerbation, injection site pain, and agitation End point Day 64 Page of 10 Day ... early stages of data analysis and dissemination The authors also wish to thank Matthew Grzywacz, PhD, Marguerite York, PhD, and ApotheCom for providing writing, editorial, and technical assistance...

Ngày tải lên: 09/08/2014, 01:21

10 442 0
Báo cáo khoa học: "Toxicity report of once weekly radiation therapy for low-risk prostate adenocarcinoma: preliminary results of a phase I/II trial" pdf

Báo cáo khoa học: "Toxicity report of once weekly radiation therapy for low-risk prostate adenocarcinoma: preliminary results of a phase I/II trial" pdf

... Rosewall T, Bayley A, et al: Phase II trial of hypofractionated image-guided intensity-modulated radiotherapy for localized prostate adenocarcinoma International journal of radiation oncology, biology, ... fractions assuming an a/ b ratio of Thus, an increase in late normal tissue complications is not anticipated Comparing with standard fractionation dose escalation trials, the Dutch trial to 78 ... late toxicity scale RTOG GRADE I II III IV None Slight epithelial atrophy; minor telangiectasia (microscopic hematuria) Moderate frequency; generalized telangiectasia; intermittent macroscopic...

Ngày tải lên: 09/08/2014, 09:21

8 322 0
Báo cáo y học: "Safety and Effectiveness of two treatment regimes with tranexamic acid to minimize inflammatory response in elective cardiopulmonary bypass patients: a randomized double-blind, dosedependent, phase IV clinical trial." pdf

Báo cáo y học: "Safety and Effectiveness of two treatment regimes with tranexamic acid to minimize inflammatory response in elective cardiopulmonary bypass patients: a randomized double-blind, dosedependent, phase IV clinical trial." pdf

... Canarias Ofra s/n, La Cuesta 38320-La Laguna Espa a 4Hematology Laboratory Hospital Universitario de Canarias Ofra s/n, La Cuesta 38320-La Laguna Espa a 5Biochemical laboratory Hospital Universitario ... Universitario de Canarias Ofra s/n, La Cuesta 38320-La Laguna Espa a Cardiac Surgery Department Hospital Universitario de Canarias Ofra s/n, La Cuesta 38320-La Laguna Tenerife Espa a Jiménez et al ... Universitario de Canarias Ofra s/n, La Cuesta 38320-La Laguna Espa a 2Nephrology Department Hospital Universitario Carlos Haya, 29010-Málaga Espa a 3Mixed Research Unit Hospital Universitario de Canarias...

Ngày tải lên: 10/08/2014, 09:22

10 414 0
Báo cáo y học: "A multicenter, double-blind, randomized, controlled phase III clinical trial of chicken type II collagen in rheumatoid arthritis" ppsx

Báo cáo y học: "A multicenter, double-blind, randomized, controlled phase III clinical trial of chicken type II collagen in rheumatoid arthritis" ppsx

... multicenter, and controlled phase III clinical trial Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by pain, swelling, and stiffness of multiple joints It is also a highly disabling ... models, including arthritis CII is the most abundant structural protein of human cartilage The cartilage within the joint caused mainly damage of autoimmunity in patients with RA CII autoimmunity may ... collagen (CII) is a major protein in articular cartilage and a potential autoantigen Some RA patients demonstrate immunity against CII, and autoantibodies to CII have been detected in the sera of both...

Ngày tải lên: 12/08/2014, 11:22

10 357 0
Báo cáo khoa học: "The epidemiology of severe sepsis in England, Wales and Northern Ireland, 1996 to 2004: secondary analysis of a high quality clinical" pps

Báo cáo khoa học: "The epidemiology of severe sepsis in England, Wales and Northern Ireland, 1996 to 2004: secondary analysis of a high quality clinical" pps

... Programme Database The Case Mix Programme Database is a high quality clinical database containing data on demographics, case mix, outcome and activity for admissions to adult, general critical care ... decreasing proportion of patients receiving mechanical ventilation Finally, although sepsis was diagnosed using raw data, the criteria used by physicians to admit patients into their ICU may have ... participated in the analysis JE conceived the study All authors were involved in interpretation of data and critical revision of the manuscript, and have read and approved the final manuscript...

Ngày tải lên: 12/08/2014, 23:22

10 340 0
vector analysis of a three-phase stator

vector analysis of a three-phase stator

... positive magnetic axis of winding aa' as shown in r Fig 2 (a) The magnitude of H a , is obtained by a Amperes Circuital Law and is given by ia N a r , where l a is the length of the path of H a and ... vector magnetic current i a on the magnetic axis of winding aa' as shown in Fig 2(b) Hence r the magnetic axis of winding aa' completes the electric circuit making i a and i a of same magnitude Fig ... magnetic axis, then the voltages i a R a and La dt to the magnetic axis of winding aa' without changing their magnitudes The vector summation r dia r of i a R a and La along the magnetic axis...

Ngày tải lên: 26/10/2014, 14:40

13 227 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... power, as well as the sensitivity analysis explain the importance of this is work in the area of renewable energy The main values calculated for this simulation and sensitivity analysis are summarized ... considered the same parameters defined in Tables and in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind...

Ngày tải lên: 05/09/2013, 14:59

14 416 1
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

... obtained This limit is called the Grid Independent Limit (GIL) The resolution of the mesh at all important areas was varied in an attempt to reach grid independent limit mesh In this typical analysis, ... fluid dynamics and its application, wind energy E-mail address: sukantamech07@gmail.com Agnimitra Biswas is a PhD student from NIT, Silchar, working under the guidance of Prof Rajat Gupta He has ... Cp at different H/D ratios Figure 27 Variation of experimental maximum Ct from computational maximum Ct at different H/D ratios Figure 26 shows the comparison of the variations of computational...

Ngày tải lên: 05/09/2013, 15:28

16 364 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

... Function in Reliability Analysis and Optimization, London: Springer, 2005 A Lisnianski, and G Levitin, Multi-state System Reliability: Assessment, Optimization and Applications Singapore: World Scientific, ... capacity of other branches are all above 5800 mAh, the system is reliable because the required capacity is reached But when we analyze the system reliability using the traditional system reliability ... conservative For example, when the required capacity is 23.4 Ah, the reliability of the system obtained by the traditional system reliability theory is only 0.25107, but the reliability of the...

Ngày tải lên: 03/01/2014, 19:38

4 408 0
Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc

Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc

... Previous work done using qualitative or semiquantitative analysis of experimental FI traces from thylakoid membranes provided limited information In particular, the characteristics of the JI phase ... This may occur simultaneously with the formation of a transmembrane voltage, as valinomycin was shown to inhibit the JI phase of thylakoid membranes [16] It is thus clear that with a saturating ... IP phase, further demonstrating that the JI phase is not directly linked to the PQ pool size and its reduction, as is the IP phase In conclusion, a simple quantitative analysis of the OJIP rise...

Ngày tải lên: 19/02/2014, 05:20

8 712 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... p26ND60, which had a Val136Ala substitution Alanine and valine are similar amino acids, indicating this modification is unlikely to affect p26 Two other nucleotides were altered in all constructs, ... sequenced in both directions, either at the Hospital for Sick Children (Toronto, Ontario, Canada) or the National Research Council Laboratory (Halifax, Nova Scotia, Canada) Sequence similarity amongst ... GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA...

Ngày tải lên: 22/02/2014, 04:20

10 495 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... linker region between domains II and III, the main hinge region for conformational change of EF-G Domain II, packing against the C-terminal end of helix AIII in domain III This interaction is ... side chains and located in domain III, domain V and the interface of domains G, III and V (B) Mutation sites in domain III that may affect the FA-binding pocket Mutation sites are shown with yellow ... 40 A shift of domain IV relative to domain III Domain III, in the middle of helix AIII in the hydrophobic core In the ribosome complex [22], this helix binds to 16S RNA and S12 Domain III, in...

Ngày tải lên: 06/03/2014, 22:21

15 475 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... Visai L, De Rossi E, Valtulina V, Casolini F, Rindi S, Guglierame P, Pietrocola G, Bellotti V, Riccardi G & Speziale P (2003) Identification and characterization of a new ligand-binding site in ... addition of peroxidase-conjugated goat anti-(rabbit IgG) Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB Analysis of ... a wide spectrum of diseases, ranging from superficial skin infections [1,2] to life-threatening diseases such as septic arthritis, pneumonia, septicemia, and endocarditis [3–7] It is also a major...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... gene assay in in vivo results Experimental procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesocricetus auratus) ... domain Fig Sequence alignment (A) Alignment of DNA binding domain (C domain) and its C-terminal extension (B) Alignment of ligand binding domain (E domain) (after helix 2) Helices as described in ... one hybrid assay showing that SmNR1 contains an autonomous transactivation function in A ⁄ B domain Individual AH109 yeast colonies obtained from an initial transformation were re-streaked on...

Ngày tải lên: 07/03/2014, 11:20

16 543 0
w