analysis an example of a high sulfur bituminous coal

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

11
679
0

báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx

Ngày tải lên : 20/06/2014, 15:20

... Küçükdeveci AA, Sahin H, Ataman S, Griffiths B, Tennant A: Issues in cross-cultural validity: Example from the adaptation, reliability and validity testing of a Turkish version of the Stanford Health Assessment ... normal population http://www.hqlo.com/content/4/1/18 writing of the manuscript AT and AE undertook the data analysis and interpretation, and also participated in writing the manuscript All authors ... correcting for bias under such circumstances This bias does not necessarily manifest though the ANOVA distributional analysis, and raises important issues about the mechanisms used to adapt scales with...

8
448
0

Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt

Ngày tải lên : 09/08/2014, 20:20

... and microsatellite genotyping, and linkage analysis EM conducted comparative genome analysis SW, EM and MVM drafted the manuscript All authors read and approved the final manuscript Additional ... of local rearrangement relative to the common placozoan-cnidarian-bilaterian ancestor [69] Previous comparative genome analysis revealed synteny blocks shared between placozoan and human genomes, ... that Placozoa are basal relative to all other non-Bilaterian animals ([70], but see [71]) Whole genome analysis of placozoan T adhaerens shows that the placozoan genome has the lowest amount of...

17
268
0

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Ngày tải lên : 11/08/2014, 05:21

... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...

8
341
0

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

Ngày tải lên : 11/08/2014, 16:21

... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...

8
315
0

Báo cáo khoa học: "The epidemiology of severe sepsis in England, Wales and Northern Ireland, 1996 to 2004: secondary analysis of a high quality clinical" pps

Ngày tải lên : 12/08/2014, 23:22

... frame and were unable to describe changes over time We present data from an analysis of a database arising from a national audit of patient outcomes from critical care units in England, Wales and ... participated in the analysis, and drafted the manuscript CW participated in the analysis JE conceived the study All authors were involved in interpretation of data and critical revision of the manuscript, ... care for England, Wales and Northern Ireland and is co-ordinated by the Intensive Care National Audit & Research Centre (ICNARC) [13] Patient data are abstracted by trained data collectors according...

10
340
0

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Ngày tải lên : 13/08/2014, 13:22

... The relation of spinal x-ray to low back pain and physical activity among 60 year old men and women Spine 1985, 10:445-451 Lean ME, Han TS, Seidell JC: Impairment of health and quality of life ... data should anyone wish to examine the source As an example of an evidence summary see Table It is at this time that the clinician is ready for the final step of applying the evidence In our example ... degeneration in an urban population Ann Rheum Dis 1958, 17:388-397 Magora A, Schwartz A: Relation between the low back pain syndrome and x-ray findings I: Degenerative osteoarthritis Scand J Rehabil...

6
402
0

A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

Ngày tải lên : 19/03/2015, 10:37

... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages Questionnaire is familiar ... has the capacity for great variety and advantages Varying vocal qualities adds interest and meaning to the messagesof the presenters The vocal characteristics of rate, volume, clarity, etc All...

50
454
2

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Ngày tải lên : 25/10/2012, 09:56

... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...

6
611
0

An example of table content

Ngày tải lên : 15/10/2013, 03:11

... 6 Reference…………………………………………… Appendix: Questionnaire………………………… ...

2
347
0

Tài liệu An Example of Using the Get* Methods phần 1 pdf

Ngày tải lên : 24/12/2013, 01:17

... Console.WriteLine("ProductName database type = " + productsSqlDataReader.GetDataTypeName(productNameColPos)); Console.WriteLine("UnitPrice database type = " + productsSqlDataReader.GetDataTypeName(unitPriceColPos)); ... Console.WriteLine("ProductID database type = " + productsSqlDataReader.GetDataTypeName(productIDColPos)); This example displays: ProductID database type = int As you can see, the ProductID column is of the SQL ... type You can see this type correspondence in Table 9.3, shown earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID...

6
594
0

Tài liệu An Example of Using the Get* Methods phần 2 docx

Ngày tải lên : 24/12/2013, 01:17

... to use some of the methods shown in Table 9.7 An Example of Using the GetSql* Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued ... SqlDataReader productsSqlDataReader = mySqlCommand.ExecuteReader(); int productIDColPos = productsSqlDataReader.GetOrdinal("ProductID"); int productNameColPos = productsSqlDataReader.GetOrdinal("ProductName"); ... that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read the columns from the Products table The following while loop uses the GetSql* methods and returned...

6
471
0

Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Ngày tải lên : 15/01/2014, 15:59

... stream! UDT – UDP-based Data Transfer Protocol • Application level transport protocol built above UDP • Reliable data delivery • End-to-end approach • Bi-directional • General transport API; ... avoidance Overlapped IO Data scattering/gathering Speculation of next packet User Buffer Data Protocol Buffer Protocol Buffer New Data API • Socket-like API • Support overlapped IO • File transfer ... Otherwise, any flow will obtain at least half of its fair share • Does not take more bandwidth than concurrent TCP flow as long as RTT ⋅ L ≤ SYN ⋅ 108 / Efficiency • UDT bandwidth utilization –...

32
580
0

Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Ngày tải lên : 16/01/2014, 21:20

... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...

8
492
0

Tài liệu An Example of Communal Currency pdf

Ngày tải lên : 17/02/2014, 19:20

... out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case the amount ... remain out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case ... without a loan and without the payment of interest It does not follow, however, that it was any more built without the aid of capital, than was St Paul's Cathedral or the Manchester Ship Canal Mr Harris,...

37
485
0

Báo cáo khoa học: Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Ngày tải lên : 08/03/2014, 02:21

... 60%) and transferred on gamma counter tubes The radioactivity was counted on a gamma counter (Riastar, Packard Instrument, USA), and each point was the mean of triplicates Binding data were analyzed ... toxic activity of pea albumin PA1b: ﬁve susceptible strains ÔS oryzae WAA42, Benin, and Bouriz, S zeamais LS, and S granarius BrayardÕ and four fully resistant S oryzae strains ÔISOR3, Mex1, China ... quantiﬁed by the measurement of the peak area and referred to known quantities of pure peptides used as standards Biological material Labeling of the toxin Cereal weevils (S oryzae, zeamais and...

7
604
0

Writing a Business Plan: An Example for a Small Premium Winery potx

Ngày tải lên : 15/03/2014, 21:20

... coordinating winery operation and Manager maintenance, sales, marketing, financial record keeping, and staffing General Manager Coordinate winery operation and maintenance, sales, marketing financial ... Management January/February 1999 Barclay, Veronica “Are You Marketing to the Affluent.” Vineyard and Winery Management January/February 2000 Bizplanit www.bizplanit.com Bureau of Labor and Statistics ... experiences and January recommendations for a lawyer (3) Send to BATF and SLA for application packets January (4) Hire a lawyer to help with the application process February (5) Have all forms and paperwork...

49
507
1

Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Ngày tải lên : 22/03/2014, 11:20

... Thanh, Nguyen Anh Tuan, Bach Gia Duong, Research, Design And Fabrication Of The 45W And The 200W, L-Band Power Amplifier Using The Modern Microstrip Technology For Application In The National ... Mehran, CAD of Microstrip Filters considering dispersion loss and discontinuity effects, IEEE Trans MTT-27, Mar (1979) 239 [3] R Mehran, A method of analysis and design of microstrip directional ... and discontinuity effects, Proc of the 1970 Informational Symposium on Computer-Aided Design of the Electrics for Space Application, Bologna (Italy) (1979) 7A [4] Dang Thi Thanh Thuy, Pham Van...

5
374
0

Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunﬂower seeds: an example of peptide splicing docx

Ngày tải lên : 29/03/2014, 09:20

... splicing A Łegowska et al ˛ A B Fig MS spectra and results of HPLC analysis of (A) [FK]BiSFTI-1 (8) and (B) a mixture of b-trypsin and [FK]BiSFTI-1: peak 2, analogue without tripeptide Abu-Thr-Lys; ... chymotrypsin with a stoichiometry of : (analogues of and 7), whereas the two remaining analogues would inhibit both trypsin and chymotrypsin simultaneously and independently Jaulent and Leatherbarrow [11] ... temperature and aliquots of the mixture were taken out periodically and submitted to RP-HPLC analysis Materials and methods Analysis of enzyme–inhibitor complexes using MS Peptide synthesis A 1.4...

9
307
0

Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt

Ngày tải lên : 30/03/2014, 16:20

... 2004) and changes in land-sea mask consistent with the latter, and an increase of psu to account for the ∼120 m sea-level lowering Vegetation and other land-surface characteristics as well as river-runoff ... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location of the Hudson Strait ice stream mouth and source, respectively the annual mean ... induces a large iceberg discharge and an ice-stream acceleration that tranlates into up to m of sea level rise, with a maximum rate of mm yr−1 (the same order of magnitude as the present-day anthropically-induced...

10
566
0