an iterated integral as a single integral

... epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis ... (Pharmacia Diagnostics) Assay performance characteristics To evaluate the performance of the assay, the precision, reproducibility and linearity were analyzed The intra-assay and interassay variabilities ... analysis, was performed with SLE and control sera Based on data from epitope analysis, we used a candidate peptide (108AARG sDMA GRGMGRGNIF122) to develop an ELISA system The new anti-Sm assay (anti-SMP)...

Ngày tải lên: 09/08/2014, 06:22

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7] ... infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and interactions between animals and humans become more proximate, the emergence...

Ngày tải lên: 02/11/2012, 11:12

... to an external page, and then rewriting those links appropriately Displaying Screens in a Portlet Our application is to operate as a single portlet, but we want to base it on an application that ... for our data source (as shown in the application code) as java:comp/env/jdbc/forum Fortunately, the database code in YAZD is concentrated in the DBConnectionManager class, and a single call to getConnection() ... login.jsp We have removed the search facility from our design, so search.jsp can go We also want our page to be an HTML fragment rather than a full page, so the header and footer pages can be deleted...

Ngày tải lên: 05/10/2013, 04:20

... Newark P Resnik, 1992 "Probabilistic Tree-Adjoining Grammar as a Framework for Statistical Natural Language Processing", Proceedings COLING92, Nantes R Scha, 1990 "Language Theory and Language ... America~ English" DARPA Speech and Naawal Language Workshop, ~ Grove, Morgan Kaufmarm F Pereira and Y Schabes, 1992 "Inside-Outside Reestimation from Partially Bracketed Corlmra', ProceedingsACY.,92, ... Godfrey and G.R Doddington, 1990 "The ATIS spoken language systems pilot corpus" DARPA Speech and Natural Language Workshop, Hidden Valley, Morgan Kaufmann Conclusions and Future Research F Jelinek,...

Ngày tải lên: 22/02/2014, 10:20

... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven ... cesarean anesthesia to the total OAAI in individual hospitals Data for 2005 (left) and 2007 (right) The OAAI correlated with epidural rates and cesarean rates more closely than did the annual ... Obst Anesth 1997, 6:250–6 10 Engen DA, Morewood GH, Ghazar NJ, Ashbury T, VanDenKerkhof EG, Wang L: A demand-based assessment of the Canadian anesthesia workforce: 2002 through 2007 Can J Anaesth...

Ngày tải lên: 05/03/2014, 15:20

... gratitude to Professor Kar-Tin Lee and Associate Professor Rod Nason for their encouragement, patience and invaluable guidance Their kind, constant and thoughtful assistance meant a great deal ... (Irene Rosanti Tjandramihardja, S.Pd., M .A. ), my lovely eightyear-old daughter (Thelma Irga Santoso), as well as my other friends (too many to Scaffolding an EFL (English as a Foreign Language) ‘Effective ... Learning Management Systems are used in the English Department, namely: TappedIn ® and MOODLE ® Each has its own advantages and disadvantages TappedIn ® is simpler to operate than MOODLE ® because...

Ngày tải lên: 19/03/2014, 07:20

... Strassel, C., Baas, M.J., Salamero, J., ChasserotGolaz, S., Cazenave, J.P., De La Salle, C & Lanza, F (2001) Biosynthesis and intracellular post-translational processing of normal and mutant platelet ... mass forms Parallel analysis of the supernatants revealed a positive signal starting at 60 of chase and having a molecular mass (82 kDa) consistent with a fully mature form This band was not observed ... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19]...

Ngày tải lên: 23/03/2014, 13:20

... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea ... relevant information In short, an Ishikawa diagram can assist memory and the retrieval of relevant medical case reports and literatures Acknowledgements I would like to thank the Journal of Medical...

Ngày tải lên: 11/08/2014, 00:23

... for strain was f/2 The Isochrysis galbana strain showed a huge range of fatty acids among, contained remarkable amount of PUFA and considerate level of EPA and DHA which play an essential role ... Matumaru, Akio Ohotake, Yoshichika Takamura, Tokujiro Adia and Masayasu Nakano (1989), “Development of a Solid medium for Growth and Isolation of Axenic Microcystis Strains (Cyanobacteria) ”, Appl ... Myristic acid Palmitic Acid Palmitoleic Acid Stearic Acid Oleic Acid Linoleic Acid Anpha-Linoleic Acid Octadecatetraenoic Eicosapentaenoic Acid (EPA) Benhenic acid Docosahexaenoic Acid (DHA) 4.16...

Ngày tải lên: 13/08/2015, 00:34

... defines AD+ , a strengthening of AD A set of reals A is 1-Borel if there is a set of ordinals S, an ordinal and a formula such that x ✓ A $ L↵ [S, x] = [S, x] If is an ordinal and A ✓ ! , then A is ... plays a important role in analysis of premice with Woodin cardinals Models of determinacy appears when we reach Woodin cardinals Given a set A ✓ X ! , the game GA is played as follows Two players ... Woodin cardinal into an S-operator and vice versa Section 3.4 concludes the proof of the ✓ = ✓↵+1 case, using the translation procedure and a reflection argument Chapter handles the ADR case The...

Ngày tải lên: 09/09/2015, 17:54

... 18S rRNA as an internal control Each RNA sample was analyzed in duplicate, using quantitative real-time RT-PCR Statistical analysis of the data is presented in Table S3 Group Organ Mean DCT Fold ... was detected with rabbit anti-FLAG serum and, as secondary antibody, anti-rabbit Texas Red serum Cells were counterstained with mouse antibodies raised against PDI (E) and donkey anti-rabbit Alexa ... storage vacuole [13] and was shown to bind to C-terminal vacuolar sorting determinants on tobacco chitinase and barley lectin [14], establishing that in plants the PA domain can serve as a ligand-binding...

Ngày tải lên: 18/02/2014, 08:20

... intensity was attained (12 s) the formation of the inhibitory product antagonized by CoA has only began and the effect of CoA at that assay time was nil or a discrete activation (always less than 20%) ... similarity between rey luciferase and acyl-CoA synthetases, our achievement is not as strange as it seems to be and supports the theory that nowadays rey luciferase evolved from an ancestral acyl-CoA ... preincubating it with ATP, acetate, MgCl2, acetyl-CoA synthetase and inorganic pyrophosphatase (PPase) Then, we conrmed that treated acetyl-CoA was no longer antagonist of L-AMP in bioluminescent reactions...

Ngày tải lên: 16/03/2014, 23:20

... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured ... Ishihara, K., Yasuda, K & Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , ... levels of transcription and translation of Hsp105, not due to an indirect effect of SA on the basal activity of Luc Enhancement of Luc activity was also detected at 45 and 60 mM SA, when pGL105/C3H...

Ngày tải lên: 17/03/2014, 10:20

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... of Japan and by the Naito Foundation and Japan Foundation for Applied Enzymology (to S K.) 3869 An antimicrobial peptide as a secretagogue References Janeway CA Jr (1989) Approaching the asymptote? ... identified as a stimulator that led to the release of histamine from rat mast cells [33] Mastoparan forms an amphiphilic a- helix, and its carboxyl terminus is amidated Mastoparan is a potent stimulator ... Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular component in horseshoe crab hemocytes, is an antimicrobial protein...

Ngày tải lên: 30/03/2014, 20:20

... J5) and Rd2 (E coli F583), diphosphoryl lipid A (E coli F583), LTA from Staphylococcus aureus, 2-oxo-3-deoxyoctanoate (KDO), laminarin, curdlan, zymosan, chitosan, mannan, glucose, galactose, mannose, ... bacteria and yeast, and caused aggregation of these micro-organisms Binding of hemolin to the surface of bacteria appears to be due to specific interactions with LPS on Gram-negative bacteria and ... Chem 275, 4995–5002 Ma, C & Kanost, M.R (2000) A b-1,3-glucan-recognition protein from an insect, Manduca sexta, agglutinates microorganisms and activates the phenoloxidase cascade J Biol Chem 275,...

Ngày tải lên: 31/03/2014, 09:20

... had increased; water was scarce and wasted through poor management of sanitation and infrastructure; average life expectancy was declining; education outcomes are poor; safety and security was ... Public Administration and Management Pretoria Van Schaik Cloete, JJN 1991 Public Administration and Management Pretoria Van Schaik Cloete, JJN 1998 South African Public Administration and Management ... public financial management CURRENT STATUS AND RELEVANCE OF PUBLIC MANAGEMENT The current status and relevance of public management teaching and research within South African traditional universities,...

Ngày tải lên: 02/04/2014, 00:13

... MRE-B is a translational researcher who has participated in many laboratory and clinical research studies, as well as several successful biotechnology company start-ups, both privately and in his ... assessing the translational potential of ideas that are still in the percolation phase The NIH intramural program is an ideal test site for such new translational research approaches, percubator ... can be evaluated in an open and transparent manner, with successful methods expanded upon and unsuccessful ones closed out for good cause based on empirical data Beyond improving the translational...

Ngày tải lên: 18/06/2014, 19:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

... ELISAs, and guided or performed image analysis, analyzed data and drafted the manuscript LJ performed tissue preparation, immunohistochemistry, image analysisand ELISAs KT carried out ELISAs and ... analysis of A Anti -A antibody ELISA Anti -A antibodies in plasma were measured by ELISA as previously described [30] ELISAs for antibody isotypes and epitope mapping were performed as previously ... has been demonstrated that non-B cell mechanisms may also have a role in clearing cerebral A [8] A multi-center A vaccine human clinical trial (AN1 792) was initiated but was suspended when approximately...

Ngày tải lên: 19/06/2014, 22:20