an example of implementation of a new technology

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

... on performance Acta Anaesthesiol Scand 2010, 54(6):689-695 Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure ... this article as: Lindström et al.: Implementation of a new emergency medical communication centre organization in Finland - an evaluation, with performance indicators Scandinavian Journal of Trauma, ... organization changes The EMD has an essential and important role in the early management of patients, and there are some difficulties in evaluating quality and effectiveness of the EMCC, as described...

Ngày tải lên: 25/10/2012, 10:02

5 496 0
Báo cáo khoa học: "An Efficient Implementation of a New POP Model" doc

Báo cáo khoa học: "An Efficient Implementation of a New POP Model" doc

... Amsterdam-Atlanta Bod, R 1992 Data Oriented Parsing, Proceedings COLING'92, Nantes, France Bod, R 1993 Using an Annotated Language Corpus as a Virtual Stochastic Grammar, Proceedings AAAI'93, Washington ... Characterization and New Examples Proceedings of 7th conference on Formal Grammar Charniak, E 1996 Tree-bank Grammars, Proceedings AAAT96, Menlo Park, Ca Charniak, E 1997 Statistical Parsing with a Context-Free ... EnglishLanguage Computer Manuals Proceedings ACL'92, Newark, Delaware Black, E., R Garside and G Leech, 1993 Statistically-Driven Computer Grammars of English: The IBM/Lancaster Approach Rodopi: Amsterdam-Atlanta...

Ngày tải lên: 31/03/2014, 20:20

8 468 0
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

... 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview sets were basically identical for both assessments ... at home and school in Tanzania [20] To date no prevalence rates for Tanzania are available [20], but Straus [17] reported that more than two thirds of Tanzanian students did not strongly disagree ... Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system Child and Adolescent...

Ngày tải lên: 13/08/2014, 18:22

9 405 0
Control and implementation of a new modular matrix converter

Control and implementation of a new modular matrix converter

... −Vcap −Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap −2Vcap −Vcap Vcap 2Vcap Vcap Vcap 2Vcap Vcap −Vcap −2Vcap −Vcap Vcap 2Vcap −2Vcap 2Vcap 2Vcap −2Vcap −2Vcap 2Vcap −2Vcap −2Vcap −2Vcap 2Vcap −2Vcap ... Phase C -Vcap+ Phase A vCA Phase a Vab = Vcap VAB = -Vcap VCA = Vcap Phase B Phase b VBC = 0V Vbc = 0V Vca = -Vcap -Vcap+ Phase A Phase a Vab = Vcap VAB = -Vcap VCA = Vcap Phase B Vca = 0V Phase ... Phase A Phase a ap+ -Vc VAB = V Vab = Vcap Phase B Phase b Phase c Phase C -Vcap+ Phase A Phase a VAB = -Vcap VCA = Vcap Phase B Vab = Vcap +Vcap+V VBC = 0V +V Phase C +Vcap-Vcap+ Phase A + Phase...

Ngày tải lên: 13/05/2014, 00:55

7 334 1
Báo cáo hóa học: " Research Article Implementation and Validation of a New Combined Model for Outdoor to Indoor Radio Coverage Predictions" pptx

Báo cáo hóa học: " Research Article Implementation and Validation of a New Combined Model for Outdoor to Indoor Radio Coverage Predictions" pptx

... Zhang, and G Clapworthy, “On the use of an intelligent ray launching for indoor scenarios,” in Proceedings of the 4th European Conference on Antennas and Propagation (EuCAP ’10), Barcelona, Spain, ... October 2004 [26] M Thiel and K Sarabandi, “3D-wave propagation analysis of indoor wireless channels utilizing hybrid methods,” IEEE Transactions on Antennas and Propagation, vol 57, no 5, pp 1539–1546, ... European Conference On Antennas and Propagation, Berlin, Germany, March 2009 [24] Y Wang, S Safavi-Naeini, and S K Chaudhuri, A hybrid technique based on combining ray tracing and FDTD methods for...

Ngày tải lên: 21/06/2014, 11:20

9 440 0
báo cáo khoa học: " Implementation of a new cost efficacy method for blood irradiation using a non dedicated device" pptx

báo cáo khoa học: " Implementation of a new cost efficacy method for blood irradiation using a non dedicated device" pptx

... collected data LS, PP, DD, CG, MLF and AS analyzed data, carried out data interpretation LS, AS and PP participated in drafting of manuscript All authors read and approved the final manuscript ... acceptance and the irradiation duration (mean 2.5 h) This procedure requires the availability of a car, a driver and an operator of the centre of Transfusion Department to deliver the irradiated ... carried out Design of a blood irradiation container and set-up To facilitate and standardize the blood component irradiation using a linear accelerator, a blood irradiator box was designed and...

Ngày tải lên: 10/08/2014, 10:20

6 292 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...

Ngày tải lên: 11/08/2014, 05:21

8 341 0
báo cáo khoa học: " Improving eye care for veterans with diabetes: An example of using the QUERI steps to move from evidence to implementation: QUERI Series" ppsx

báo cáo khoa học: " Improving eye care for veterans with diabetes: An example of using the QUERI steps to move from evidence to implementation: QUERI Series" ppsx

... conditions; and 5) advancing clinically-meaningful quality/performance measurement as an important tool for promoting and assessing quality improvement interventions Examples of work by DM-QUERI that address ... Often, the transition from research breakthrough to clinical practice takes many years and progresses haphazardly due to fragmentation in funding, a lack of partnerships and no consistent framework ... researchers, policymakers and Table 1: The VA Quality Enhancement Research Initiative (QUERI) The U.S Department of Veterans Affairs' (VA) Quality Enhancement Research Initiative (QUERI) was launched...

Ngày tải lên: 11/08/2014, 16:21

11 443 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...

Ngày tải lên: 11/08/2014, 16:21

8 315 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

... The relation of spinal x-ray to low back pain and physical activity among 60 year old men and women Spine 1985, 10:445-451 Lean ME, Han TS, Seidell JC: Impairment of health and quality of life ... data should anyone wish to examine the source As an example of an evidence summary see Table It is at this time that the clinician is ready for the final step of applying the evidence In our example ... and health promotion Am J Prev Med 1992, 8:154-158 Bowerman S, Bellman M, Saltsman P, Garvey D, Pimstone K, Skootsky S, Wang HJ, Elashoff R, Heber D: Implementation of a primary care physician...

Ngày tải lên: 13/08/2014, 13:22

6 402 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages Questionnaire is familiar ... has the capacity for great variety and advantages Varying vocal qualities adds interest and meaning to the messagesof the presenters The vocal characteristics of rate, volume, clarity, etc All...

Ngày tải lên: 19/03/2015, 10:37

50 454 2
Structuring an advertising business in Vietnam (an example of FPT media - the corporation for financing and promoting technology)

Structuring an advertising business in Vietnam (an example of FPT media - the corporation for financing and promoting technology)

... important Designing a structure that fit a company’s need is a large challenge Each structure has advantages and disadvantages, and managers have to be ready and willing to redesign the organization ... the authority possessed by managers at each level decrease, as does their area of responsibility A flat of organization has fewer managers and hierarchical levels than a tall organization, so a ... a flat organization’s managers possess relatively more authority and responsibility than a tall organization’s manager Motivation in an organization with a flat structure may be stronger than...

Ngày tải lên: 26/03/2015, 08:55

104 1,5K 2
 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...

Ngày tải lên: 25/10/2012, 09:56

6 612 0
An example of table content

An example of table content

... 6 Reference…………………………………………… Appendix: Questionnaire………………………… ...

Ngày tải lên: 15/10/2013, 03:11

2 347 0
Tài liệu An Example of Using the Get* Methods phần 1 pdf

Tài liệu An Example of Using the Get* Methods phần 1 pdf

... Console.WriteLine("ProductName database type = " + productsSqlDataReader.GetDataTypeName(productNameColPos)); Console.WriteLine("UnitPrice database type = " + productsSqlDataReader.GetDataTypeName(unitPriceColPos)); ... Console.WriteLine("ProductID database type = " + productsSqlDataReader.GetDataTypeName(productIDColPos)); This example displays: ProductID database type = int As you can see, the ProductID column is of the SQL ... type You can see this type correspondence in Table 9.3, shown earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID...

Ngày tải lên: 24/12/2013, 01:17

6 594 0
Tài liệu An Example of Using the Get* Methods phần 2 docx

Tài liệu An Example of Using the Get* Methods phần 2 docx

... to use some of the methods shown in Table 9.7 An Example of Using the GetSql* Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued ... SqlDataReader productsSqlDataReader = mySqlCommand.ExecuteReader(); int productIDColPos = productsSqlDataReader.GetOrdinal("ProductID"); int productNameColPos = productsSqlDataReader.GetOrdinal("ProductName"); ... that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read the columns from the Products table The following while loop uses the GetSql* methods and returned...

Ngày tải lên: 24/12/2013, 01:17

6 471 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...

Ngày tải lên: 16/01/2014, 21:20

8 493 0
Tài liệu An Example of Communal Currency pdf

Tài liệu An Example of Communal Currency pdf

... out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case the amount ... remain out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case ... without a loan and without the payment of interest It does not follow, however, that it was any more built without the aid of capital, than was St Paul's Cathedral or the Manchester Ship Canal Mr Harris,...

Ngày tải lên: 17/02/2014, 19:20

37 485 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... purpureus and F scutaria larvae sequences have a H64 also shared by A gambiae, A aegypti, T gigas, D melanogaster-2 and D melanogaster-3 sequences (data not shown) By contrast, R pachyptila amino acid ... CAIV isoforms when FCA -a and FCA-b [25] The Riftia sequences are also phylogenetically distant from the mosquitoes Aedes aegypti and Anopheles gambiae CA sequences, and not contain any GPI-anchored...

Ngày tải lên: 18/02/2014, 16:20

14 591 0
w