an example of a method transfer protocol

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...

Ngày tải lên: 11/08/2014, 05:21

... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...

Ngày tải lên: 11/08/2014, 16:21

... The relation of spinal x-ray to low back pain and physical activity among 60 year old men and women Spine 1985, 10:445-451 Lean ME, Han TS, Seidell JC: Impairment of health and quality of life ... data should anyone wish to examine the source As an example of an evidence summary see Table It is at this time that the clinician is ready for the final step of applying the evidence In our example ... degeneration in an urban population Ann Rheum Dis 1958, 17:388-397 Magora A, Schwartz A: Relation between the low back pain syndrome and x-ray findings I: Degenerative osteoarthritis Scand J Rehabil...

Ngày tải lên: 13/08/2014, 13:22

... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... scientifically and objectively than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages ... has the capacity for great variety and advantages Varying vocal qualities adds interest and meaning to the messagesof the presenters The vocal characteristics of rate, volume, clarity, etc All...

Ngày tải lên: 19/03/2015, 10:37

... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...

Ngày tải lên: 25/10/2012, 09:56

... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on ... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that...

Ngày tải lên: 03/04/2013, 21:07

... 6 Reference…………………………………………… Appendix: Questionnaire………………………… ...

Ngày tải lên: 15/10/2013, 03:11

... type You can see this type correspondence in Table 9.3, shown earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID ... Console.WriteLine("ProductName database type = " + productsSqlDataReader.GetDataTypeName(productNameColPos)); Console.WriteLine("UnitPrice database type = " + productsSqlDataReader.GetDataTypeName(unitPriceColPos)); ... Console.WriteLine("ProductID database type = " + productsSqlDataReader.GetDataTypeName(productIDColPos)); This example displays: ProductID database type = int As you can see, the ProductID column is of the SQL...

Ngày tải lên: 24/12/2013, 01:17

... UnitsInStock smallint GetSqlInt16() SqlInt16 Discontinued bit GetSqlBoolean() SqlBoolean Let's assume that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read the ... SqlDataReader productsSqlDataReader = mySqlCommand.ExecuteReader(); int productIDColPos = productsSqlDataReader.GetOrdinal("ProductID"); int productNameColPos = productsSqlDataReader.GetOrdinal("ProductName"); ... use to retrieve a particular column type, you use Table 9.7, shown earlier For example, the ProductID column is a SQL Server int, and looking up that type in Table 9.7, you can see you use the...

Ngày tải lên: 24/12/2013, 01:17

... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...

Ngày tải lên: 16/01/2014, 21:20

... out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case the amount ... remain out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case ... without a loan and without the payment of interest It does not follow, however, that it was any more built without the aid of capital, than was St Paul's Cathedral or the Manchester Ship Canal Mr Harris,...

Ngày tải lên: 17/02/2014, 19:20

... coordinating winery operation and Manager maintenance, sales, marketing, financial record keeping, and staffing General Manager Coordinate winery operation and maintenance, sales, marketing financial ... Management January/February 1999 Barclay, Veronica “Are You Marketing to the Affluent.” Vineyard and Winery Management January/February 2000 Bizplanit www.bizplanit.com Bureau of Labor and Statistics ... experiences and January recommendations for a lawyer (3) Send to BATF and SLA for application packets January (4) Hire a lawyer to help with the application process February (5) Have all forms and paperwork...

Ngày tải lên: 15/03/2014, 21:20

... (5¢-TCATAAGGCGGCCGCCTACATCG ATCTTAATCTGCTCAA-3¢) A fragment carrying At3g21260 cDNA was amplifed from A thaliana RNA by RT-PCR RNA was isolated from A thaliana tissues using an RNeasy plant mini ... GLTP1PRONBAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAA GGTGGG-3¢) A 1.3 kb fragment carrying the At1g21360 promoter was amplified using primers 21360PRUXBA (5¢-AACGATCTAGATTAAGAATGTAATCACATTAGG GT-3¢) and 21360PRNNBAM ... between glutathione S-transferase (GST) and AtGLTP1 in the plasmid pGEX-GLTP1 The cDNA was amplified from U66003 using primers U660035Eco2 (5¢-AATAGA GAATTCAGAGAAAGAGATACGAGATGGA-3¢) and U660033Not...

Ngày tải lên: 23/03/2014, 07:20

... chymotrypsin with a stoichiometry of : (analogues of and 7), whereas the two remaining analogues would inhibit both trypsin and chymotrypsin simultaneously and independently Jaulent and Leatherbarrow [11] ... splicing A Łegowska et al ˛ A B Fig MS spectra and results of HPLC analysis of (A) [FK]BiSFTI-1 (8) and (B) a mixture of b-trypsin and [FK]BiSFTI-1: peak 2, analogue without tripeptide Abu-Thr-Lys; ... 2486.4686 and 2762.4797 revealed the appearance of a : complex of trypsin with monocyclic SFTI-1 (Fig 3B) Essentially, an identical peak pattern was seen with an increasing incubation time of up...

Ngày tải lên: 29/03/2014, 09:20

... 2004) and changes in land-sea mask consistent with the latter, and an increase of psu to account for the ∼120 m sea-level lowering Vegetation and other land-surface characteristics as well as river-runoff ... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location of the Hudson Strait ice stream mouth and source, respectively the annual mean ... induces a large iceberg discharge and an ice-stream acceleration that tranlates into up to m of sea level rise, with a maximum rate of mm yr−1 (the same order of magnitude as the present-day anthropically-induced...

Ngày tải lên: 30/03/2014, 16:20

... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection; ... increase Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and...

Ngày tải lên: 18/06/2014, 22:20

... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection; ... increase Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and...

Ngày tải lên: 20/06/2014, 16:20

... Medical Center, Taiwan Author Details 1Department of Pharmacy, Chi-Mei Medical Center, Tainan, Taiwan, 2Department of Hospital and Health Care Administration, Chia-Nan University of Pharmacy and ... 5Department of Radiation Oncology, Taipei Medical University, Shuang Ho Hospital, Taipei, Taiwan and 6Department of Emergency, Chi-Mei Medical Center, Tainan, Taiwan Received: 12 January 2010 Accepted: ... The Sage handbook of quantitative methodology for the social sciences Edited by: Kaplan D Thousand Oaks CA: Sage:73-92 Wilkinson L, APA: Task Force on Statistical Inference: Statistical methods...

Ngày tải lên: 20/06/2014, 16:20

... (presentations available at project’s homepage) To enable further exchange of experiences and information about the research potential and capacities of local (Serbian) and regional research institutions and ... several aquatic and terrestrial acute and chronic toxicity tests using Vibrio fischeri, Pseudokirchneriella subcapitata, Caenorhabditis elegans, Lactuca sativa, Folsomia candida and Enchytraeus albidus ... subsessions, (a) legislative aspect; (b) emerging substances and nanomaterials: analyses, environmental fate, effects, ERA; and (c) incorporating omic information into risk assessment and policy) and (2)...

Ngày tải lên: 21/06/2014, 06:20