an ad hoc solution for a particular incident

... user, Boston, Mass, USA, 2001 a 32 M Bohner and A Peterson, Advances in Dynamic Equations on Time Scales, Birkh¨ user, Boston, Mass, a USA, 2003 33 V Lakshmikantham and A S Vatsala, “Hybrid systems ... scale,” Journal of Mathematical Analysis and Applications, vol 319, no 1, pp 315–325, 2006 35 R Agarwal, M Bohner, and A Peterson, “Inequalities on time scales: a survey,” Mathematical Inequalities ... scales,” Journal of Computational and Applied Mathematics, vol 141, no 1-2, pp 227–235, 2002 34 E R Kaufmann and Y N Raffoul, “Periodic solutions for a neutral nonlinear dynamical equation on a...

Ngày tải lên: 21/06/2014, 07:20

... 695–698, 1955 V A Marchenko, Sturm-Liouville Operators and Applications, vol 22 of Operator Theory: Advances and Applications, Birkh¨ user, Basel, Switzerland, 1986 a B M Levitan, “On the solution of ... a a, and hence 2a − α − 2a k − y < 2a − 2a k 3.9 a − a − 2a k − αx < a − α ≤ μ x x, and hence, for this case, the inequality holds If x ≥ a, then μ x Therefore, for y > μ x 3.2 takes the form ... ds dz x t a z−x a a αx 1 1− − α a q z K z, s ds dz t z a a αx ∞ t z a a αx q z K z, s ds dz, a a αx t−z a a αx a; K x, t 1.23 t−z a a αx a 1 1− α for < x < a, t > −αx a; ∞ α 2α a ∞ q z...

Ngày tải lên: 21/06/2014, 16:20

... 695–698, 1955 V A Marchenko, Sturm-Liouville Operators and Applications, vol 22 of Operator Theory: Advances and Applications, Birkh¨ user, Basel, Switzerland, 1986 a B M Levitan, “On the solution of ... a a, and hence 2a − α − 2a k − y < 2a − 2a k 3.9 a − a − 2a k − αx < a − α ≤ μ x x, and hence, for this case, the inequality holds If x ≥ a, then μ x Therefore, for y > μ x 3.2 takes the form ... ds dz x t a z−x a a αx 1 1− − α a q z K z, s ds dz t z a a αx ∞ t z a a αx q z K z, s ds dz, a a αx t−z a a αx a; K x, t 1.23 t−z a a αx a 1 1− α for < x < a, t > −αx a; ∞ α 2α a ∞ q z...

Ngày tải lên: 21/06/2014, 16:20

... Mathematical Analysis and Applications, vol 296, no 1, pp 265–275, 2004 27 Z Wei and C Pang, “Positive solutions of some singular m-point boundary value problems at nonresonance,” Applied Mathematics ... first order derivative,” Journal of Mathematical Analysis and Applications, vol 290, no 1, pp 291–301, 2004 15 R A Khan and J R L Webb, “Existence of at least three solutions of a second-order ... H Wang, “Positive solutions of nonlinear three-point boundary-value problems,” Journal of Mathematical Analysis and Applications, vol 279, no 1, pp 216–227, 2003 22 P K Palamides, “Positive and...

Ngày tải lên: 21/06/2014, 18:20

... Benchohra, A Cabada, and D Seba, An existence result for nonlinear fractional differential equations on Banach spaces,” Boundary Value Problems, vol 2009, Article ID 628916, 11 pages, 2009 B Bonilla, ... “Differential and integral relations involving fractional derivatives of Airy functions and applications,” Journal of Mathematical Analysis and Applications, vol 348, no 1, pp 101–115, 2008 M P Lazarevi´ ... Daftardar-Gejji and S Bhalekar, “Boundary value problems for multi-term fractional differential equations,” Journal of Mathematical Analysis and Applications, vol 345, no 2, pp 754–765, 2008 V Varlamov,...

Ngày tải lên: 21/06/2014, 20:20

... 3.6 Set An 2I − Tn −1 for all n 1, 2, , N, it is well known that {An }N are all nonexpansive n mappings and Fix An Fix Tn as a consequence of 10, Theorem Then we have An A 1 xn − An xn ≤ ... 96-2221-E-230-003 10 Journal of Inequalities and Applications References H K Xu and R G Ori, An implicit iteration process for nonexpansive mappings,” Numerical Functional Analysis and Optimization, vol 22, ... referee for his/her careful reading The first author was partially supposed by National Natural Science Foundation of China, Grant no 10771050 The second author was partially supposed by the Grant...

Ngày tải lên: 22/06/2014, 22:20

... Intervention Research Washington DC: National Academy Press 1994 van’t Veer-Tazelaar N, van Marwijk H, van Oppen P, Nijpels G, van Hout H, Cuijpers P, Stalman W, Beekman A: Prevention of anxiety and depression ... prevention trial and Research Assistant to Professor Christensen PJB Expertise in statistical analysis and data management of large-scale behavioural research studies, and experience in the design and ... psychometric measures, screening and diagnosis tests, modelling longitudinal data, and the conduct and analysis of controlled trials and interventions in mental health KK Trial Manager for the WebGAD prevention...

Ngày tải lên: 11/08/2014, 16:22

... B' A' D' Hoạt động học sinh r u ur uu a) Xét phép tịnh tiến theo vectơ v = AA' : r Tv : A A, D D nên AD AD Phép đối xứng qua mặt phẳng (P) = (ACCA) biến AD thành AB ( (P) (ABCD) nên A A, ... điểm CD Lại A1 tâm BCD A1 B1, B1C1, C1D1, D 1A1 nên B, A1 , I thẳng hàng a với a cạnh tứ diện IA IB - Ta có = = A1 B1 // AB suy đợc: ABCD cho IB IA - Củng cố khái niệm a diện A1 B1 a = A1 B1 = Chứng ... ACDA BCCA trục c) ACDA CABC A D - Gọi học sinh thực tập d) ACDA BAAC đợc chuẩn bị nhà - Nêu đợc cách xác định ảnh điểm, O hình đơn giản C' B' A' D' Hoạt động 2: Giáo án hình học 12 - ban khoa...

Ngày tải lên: 06/07/2013, 01:26

... the broadcast-relay transmission strategy in linear, rectangular, and hexagonal networks, respectively, for any arbitrary-cast case, including unicast, multicast, and broadcast This transmission ... providing a scalable transmission with the number of users/terminals Surfaces (a) and (b) are for the traditional strategy of broadcast case in rectangular and hexagonal networks, respectively, and ... slots for our transmission strategy and n + 3b − time slots for the traditional strategy Therefore, for an arbitrary-cast case, including unicast, multicast, and broadcast, in a full distance-n...

Ngày tải lên: 21/06/2014, 22:20

... P Agarwal and D O’Regan, Difference equations in abstract spaces, Journal of Australian Mathematical Society Series A 64 (1998), no 2, 277–284 [2] R P Agarwal, D O’Regan, and V Lakshmikantham, ... Editura Academiei, Bucharest, 1988 [14] A Rousseau, R Temam, and J Tribbia, Boundary conditions for an ocean related system with a small parameter, Nonlinear Partial Differential Equations and Related ... and D W Krumme, Differential-difference equations and nonlinear initial-boundary value problems for linear hyperbolic partial differential equations, Journal of Mathematical Analysis and Applications...

Ngày tải lên: 22/06/2014, 22:20

... Equations 180 (2002), no 1, 1–50 D D Hai and R Shivaji, An existence result on positive solutions for a class of p-Laplacian systems, Nonlinear Anal 56 (2004), no 7, 1007–1010 S Oruganti and ... 27402, USA E-mail address: maya@uncg.edu R Shivaji: Department of Mathematics and Statistics, Mississippi State University, Mississippi State, MS 39762, USA E-mail address: shivaji@math.msstate.edu ... quasilinear a a elliptic problems, Nonlinear Anal Ser A: Theory Methods 44 (2001), no 2, 189–204 P Dr´ bek, P Krejˇ ´, and P Tak´ c, Nonlinear Differential Equations, Chapman & Hall/CRC Rea cı a ...

Ngày tải lên: 23/06/2014, 00:20

... semantic attributes and sensor data for target classification There are two algorithms: data processing and data classification CPA event data are divided into training and test sets The training ... Pennsylvania State University She has led multiorganizational advanced research programs and laboratories in major US industrial and academic institutions She pioneered the use of formal methods for ... prognosis and maintenance planning over the National Information Infrastructure derived from online physics-based analysis of emerging damage She has established Dynamic Agent Classification and Tracking...

Ngày tải lên: 23/06/2014, 01:20

... AND $var 20 AND $var 30 AND $var

Ngày tải lên: 27/06/2014, 12:20

... HGT between archaea and bacteria (13% from archaea to bacteria, 23% from bacteria to archaea and 8% in both directions; see Materials and methods for details and Additional data file 3) In the rest ... metabolism and transport; G, carbohydrate metabolism and transport; H, coenzyme metabolism and transport; I, lipid metabolism; J, translation and ribosome biogenesis; K, transcription; L, replication and ... used to analyze possible cases of HGT between bacteria and archaea in those trees that include at least five archaeal species and at least five bacterial species The value of the B /A score ranges...

Ngày tải lên: 06/08/2014, 19:20

... following a single -incident trauma Chemtob, Nakashima and Hamada [19] and Stein and colleagues [20] provided school-based interventions to children experiencing trauma symptoms following a hurricane and ... significance and provides innovations at many points along a clinical care continuum For the first time, children and adolescents presenting to Australian hospitals following an accidental injury ... Cognitivebehavioral therapy for PTSD in children and adolescents: A preliminary randomized controlled trial Journal of the American Academy of Child and Adolescent Psychiatry 2007, 46:1051-1061 22 Cobham...

Ngày tải lên: 11/08/2014, 16:22

... Brisbane QLD 4101, Australia 4School of Psychology, Flinders University, Adelaide SA 5001, Australia Received: 19 January 2011 Accepted: 20 January 2011 Published: 20 January 2011 References Kenardy ... Queensland, Herston QLD 4029, Australia School of Psychology, University of Queensland, St Lucia QLD 4072, Australia 3Child and Youth Mental Health Service, Mater Children’s Hospital, Annerley Road, ... American Journal of Psychiatry 2006, 163:644-651 Scheeringa MS, Zeanah CH, Myers L, Putnam FW: New findings on alternative criteria for PTSD in preschool children Journal of the American Academy...

Ngày tải lên: 11/08/2014, 16:23

... translation of an ORF from an influenza A virus genomic RNA, however, these data reinforce the fact that molecular processes are not perfect and that errors in transcriptional and translational ... reading frame 169 S>N no change 239 no change no change 311 no change no change 341 no change I>M 350 no change no change 379 R>K no change 404 no change no change 407 no change I>M 447 no change ... the idea for the work, performed some analyses and wrote the manuscript MC and JT performed data collection and analyses Acknowledgements We would like to thank the many programmers who have contributed...

Ngày tải lên: 12/08/2014, 04:20

... GGCCG.AGG AAC.AUGCC GAUUUGAUA AUCAGCUUGCG.GGCAU UAAAAAACA GCUAAAGC.GGU GCA AAGUGUGGACAGAUUU GAGCAGCUUGCA.ACCACGGAAAAAAAU GCUAAAACACGUC UUG UUCGGCGCC GAUUUGC CUGAUCCGCUUGCG.GGCGCCUCUUAUAAAUCCAGCUAAAGA.GGUCUGAAU ... CGGUCGGCUUGCA.GCCACGUUAAACAAGUC GCUAAAG GACCG.UUG AGCCGUGGU GCUUUG UGCCGGAUUGCGGGCCACGUUAAAGAAACC GCUAAAGA.GGCG AGG ACUCGUGGU CAUUUGAGC.CGGCCGGCUUGCA.GCCACGUUAAACAACUC GCUAAACA.GGCCG.GGG UCCCGUGGU GAUUUGAG.CCGGCCGGCUUGCA.GCCACGUUAAACAAGUC ... GAUUUGAG.CCGGCCGGCUUGCA.GCCACGUUAAACAAGUC GCUAAACA.GGCCGGGGA UCCCGUGGU GAUUUGGC CGGUCGGCUUGCA.GCCACGUUAAACAAGUA GCUAAAAA.GGCCG.GGU AUCCGUGGU GAUUUGGC CGGCCGGCUUGCA.GCCACGUUAAAGAAGUC GCUAAAG GGCCG.AGG...

Ngày tải lên: 14/08/2014, 14:22

... observation area to answer questions • hour – return to Nha So Ba for sharing and comments at 9:30am 11/2010 SPERI-FFS What is biogas? • A gas that can be burned to give energy • Biogas is made ... digestion is done in water, without any air • Bacteria and other microbes in the water eat the organic matter, produce biogas and give nutrients back to the water • This is called anaerobic digestion ... SPERI-FFS Anaerobic Digestion Needs: One or more airtight containers to catch the gas and to hold water & manure  11/2010  Bacteria to start the process – fresh cow/buffalo manure has this naturally...

Ngày tải lên: 05/04/2015, 17:22

... people Navigate to Understand Behavioral layer target area speech Motion and Audio and Vision Speech Animation localization gestures task task task Mobile platform Speakers Camera/s Microphone/s Animated ... robotic task include personal assistant, companion robot and handicap aid as seen in Figure 1-1 Figure 1-1: Role of Social Robots in today’s society, as companion to elderly, children and assistant ... platform has seen a rise of demand for high mobility platforms While high mobility platforms are in demand, commercial systems have to balance many other factors such as price and turn-around time...

Ngày tải lên: 04/10/2015, 10:26