alzheimer s disease through the application of a multicriteria classification model
Improving Maternal, Newborn, Child Health, and Family Planning Programs through the Application of Collaborative Improvement in Developing Countries: A Practical Orientation Guide pptx
Ngày tải lên :
23/03/2014, 06:20
... supportive coaching of teams, process analysis of services, and the use of data to monitor results and decision making Based on these values, the collaborative improvement approach has taken these principals ... MNCH and FP programs through collaborative improvement · Essential Obstetric Care: The use of partograph increased substantially in Afghanistan and Guatemala and the application of active management ... concepts so that they can apply them on their own to address whatever health problem they may chose to address Steps to sustain the gains and institutionalize the successful changes tested by a collaborative...
- 34
- 542
- 0
Screening of early and late onset alzheimer’s disease genetic risk factors in a cohort of dementia patients from liguria, italy
Ngày tải lên :
15/02/2017, 15:58
... significantly associated with disease status in both comparisons (AD + MCI vs NCs and AD only vs NCs) (Table 3b) Only the rs3818361 risk allele for CR1associated with disease status (Pearson s Chi2 test: ... and 2) used data from pure AD and MCI cases for the analysis of LOAD risk factors in comparison with the NCs Sequencing of the EOAD candidate genes (APP, PSEN1 and PSEN2) revealed two missense ... cases and controls 3.2 Haplotype Analyses and Association with Disease Status (AD and/or AD + MCI) No haplotype block or pair wise LD could be established at the PSEN1, GRN and TARDBP loci (data...
- 11
- 467
- 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
Ngày tải lên :
06/09/2013, 05:48
... realigning their marketing mechanisms and strategies to attract less educated masses through staff trainings and holding open sessions in these localities and persuading them in their respective languages ... qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards regulated microfinance institutions ANALYSIS The analysis ... strongest target market in Pakistan The MFIs may also facilitate the borrowers to establish strategic alliances on profit sharing basis with the educated middle income classes, hence enabling both the...
- 23
- 552
- 0
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx
Ngày tải lên :
18/06/2014, 17:20
... professional associations have a say in decisions about the number of specialists to be trained, and in this sense it shares with the United States aspects of the ‘professional’ model Health organization ... simulations are essentially time-step simulations The model takes a number of simulation steps along the time axis System Dynamics makes extensive use of diagrams, especially of two types: causal ... quantitative analysis of system dynamics behaviour, and they have two kinds of variables Page of Stock or levels variables describe the states of the system, such as the number of medical specialists,...
- 9
- 543
- 1
Lithium-Ion Battery Systems: A Process Flow And Systems Framework Designed For Use In The Development Of A Lifecycle Energy Model
Ngày tải lên :
10/12/2016, 09:56
... anode material instead of carbon based graphite Silicon has a high storage capacity of up to ten times that of graphite, but has a shorter life as a material and can cause pulverization (American ... lithium and are known by variety of names: continental saline desert basins, salars, salt lakes, and salt flats, depending upon the region These brines are composed of “sand, minerals with brine, and ... Therefore, a comprehensive understanding of the system in which the technology and resources reside is necessary to establish resource security, assess the benefits of resource recycling, and assess future...
- 107
- 404
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ ... urea Mass spectrometry, amino acid analysis and sequencing Amino acid analysis was performed at the Amino Acid Analysis Center, University of Uppsala, Sweden Sequence analysis was performed using ... gels (A, C) and 1% agarose gels (B,D), and proteins were visualized by Coomassie stain Lanes HS and LS are molecular mass standards, with the molecular mass in kDa given on the left (E) 1% agarose...
- 16
- 691
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... AD affected brain, metal dyshomeostasis is evident in the form of a substantial increase in the levels of extracellular metals and a decrease in the levels of intracellular metals Here, we have ... is of particular relevance These authors demonstrated that an increase in oxidative stress alters APP processing and generates an increase in Ab production If an oxidative stressinduced increase ... Ceruloplasmin is increased in cerebrospinal fluid in Alzheimer s disease but not Parkinson s disease Alzheimer Dis Assoc Disord 8, 190–197 Hye A, Lynham S, Thambisetty M, Causevic M, Campbell J, Byers...
- 9
- 634
- 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
Ngày tải lên :
18/06/2014, 22:20
... samples by the absorbance of wells containing medium alone Statistical Analysis Statistical parameters (mean, standard deviation (SD), significant difference, etc.) were calculated using Prism ... 3.03 software (GraphPad Software, Inc., CA) Statistically significant differences were examined using a t-test or analysis of variance (ANOVA) and Tukey s multiple comparisons post-test (a P value ... trial using the AN1792 vaccine confirmed that anti-Ab antibodies are beneficial for AD patients and may at least slow the progression of a disease However this trial raised concerns about the safety...
- 15
- 431
- 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
Ngày tải lên :
19/06/2014, 22:20
... drugs on risk of Alzheimer' s disease: systematic review and meta-analysis of observational studies Bmj 2003, 327:128 Stewart WF, Kawas C, Corrada M, Metter EJ: Risk of Alzheimer' s disease and ... 23:134-147 Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer' s disease brains ... the c- Alzheimer' s disease is characterized by a variety of proinflammatory responses that act in concert to promote the progressive pathophysiology associated with this disease The results summarized...
- 12
- 413
- 0
báo cáo hóa học: " Replication of the association of HLA-B7 with Alzheimer''''s disease: a role for homozygosity?" pptx
Ngày tải lên :
19/06/2014, 22:20
... alpha and risk of Alzheimer' s disease and vascular dementia: a case-control study Lancet 2001, 357:436-439 Small GW, Scott WK, Komo S, Yamaoka LH, Farrer LA, Auerbach SH, Saunders AM, Roses AD, ... Gill S, Samii A: Effect of non-steroidal anti-inflammatory drugs on risk of Alzheimer' s disease: systematic review and meta-analysis of observational studies BMJ 2003, 327:128-132 McCusker SM, ... drugs is associated with reduced risk of AD [4-6] The region has proved a challenge for the study of disease associations, because it is highly variable, with a complex structure of linkage disequilibrium...
- 7
- 286
- 0
PET in the Evaluation of Alzheimer’s Disease and Related Disorders docx
Ngày tải lên :
05/03/2014, 23:20
... important to accurately diagnose dementia as early as possible This chapter outlines the basic elements of a clinical diagnostic evaluation for Alzheimer s disease (AD) and other dementias; and also ... mental status examination, the physician formulates diagnostic hypotheses The physician then considers all of the data gathered about the patient s history, functional status, laboratory test results, ... visual analysis of scans, describes how quantification with clinically available and friendly software tools can be employed to assist with analysis, and then illustrates a straightforward approach...
- 231
- 535
- 0
The Handbook of Alzheimer’s Disease and Other Dementias doc
Ngày tải lên :
14/03/2014, 21:20
... Hypothesis Carmela R Abraham 262 viii Contents Other Mechanisms of Neurodegeneration Marina Boziki, Vassilis Papaliagkas, and Magda Tsolaki 277 10 Rational Therapeutics for Alzheimer s Disease and ... clinical and scientific research into the causes, mechanisms, and treatment of Alzheimer s disease and related dementias The first of these was establishing the National Institute on Aging at the National ... of persons without the disease who are accurately diagnosed as not having the disease) , and what is meant by disease. ” As we go to press, AD remains a clinical diagnosis which for years has been...
- 664
- 894
- 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx
Ngày tải lên :
16/03/2014, 23:20
... c-secretase assays, an in vitro assay using COS7SPC99-3FLAG CHAPSO extracts was developed The substrate in this assay is synthesized, processed, and trafficked in the cell and would theoretically ... inhibitor of csecretase cleavage of APP Results Design of a novel APP c-secretase substrate and standards Sensitive western blot assays for c-secretase were based on the production of a 3FLAG-tagged ... collected and aliquots assayed for c-secretase activity using exogenous MC99-3FLAG substrate and phospholipids Gamma-secretase activity was measured by densitometry as described Gamma-secretase activity...
- 14
- 420
- 0
Alterations of matrix metalloproteinases in the healthy elderly with increased risk of prodromal Alzheimer’s disease pot
Ngày tải lên :
22/03/2014, 14:20
... community-based mean values In the present study the cognitive assessment also included the Alzheimer s Disease Assessment Scale (ADAS-cog 85 points), clock test, cube copying test and A Quick Test of cognitive ... developed any overt cognitive dysfunction Abbreviations Ab: b-amyloid; AD: Alzheimer s disease; ADAS-cog: Alzheimer s Disease Assessment Scale; APOE: apolipoprotein E; AQT: A Quick Test of cognitive speed; ... doi:10.1186/alzrt44 Cite this article as: Stomrud et al.: Alterations of matrix metalloproteinases in the healthy elderly with increased risk of prodromal Alzheimer s disease Alzheimer s Research & Therapy...
- 8
- 443
- 0
Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc
Ngày tải lên :
23/03/2014, 10:21
... Although calpains may enhance caspase activity, they can also function to block the activation of caspases For example, calpains can cleave caspase rendering it incapable of activating caspase and ... suggested a possible cascade of events involving three protease systems: calpain-induced cathepsin release, cathepsin-mediated caspase activation and caspase-mediated calpastatin degradation leading ... that has been implicated in neuronal cell death [7] (Fig 1) Cross-talk between calpains and caspases The striking similarity between the substrates for caspases and calpains raises the possibility...
- 7
- 341
- 0
báo cáo hóa học: " Using animal models to determine the significance of complement activation in Alzheimer''''s disease" pptx
Ngày tải lên :
19/06/2014, 22:20
... K, Nakamura S, Takashima A, Ono F, Sakakibara I, Ishii Y, Kyuwa S, Yoshikawa Y: Age-related changes of Alzheimer' s disease- associated proteins in cynomolgus monkey brains Biochem Biophys Res Commun ... complement activation because of the presence of NFTs as well as plaques Other animal species Scattered reports of AD-type pathology in other species have also appeared Adding trace amounts of copper ... Immunological aspects of microglia: relevance to Alzheimer' s disease Neurochem Int 2001, 39:381-391 Meda L, Baron P, Scarlato G: Glial activation in Alzheimer' s disease: the role of Abeta and its associated...
- 12
- 628
- 0
báo cáo hóa học: " Vascular consequences of passive Aβ immunization for Alzheimer''''s disease. Is avoidance of "malactivation" of microglia enough?" docx
Ngày tải lên :
19/06/2014, 22:20
... that the appearance of CAA after immunization may represent an actual increase in this parameter triggered by anti -A antibodies Furthermore, the investigators also found that the CAA was accompanied ... mechanisms to both A clearance and vascular pathology illustrate a somewhat unique example of microglial ambivalence While many had argued that microglial "activation" by A was at least partially ... partially responsible for AD-associated degeneration, others had pointed to microglial phagocytosis as a desirable consequence of activation For the purposes of discussion, the term "malactivation"...
- 4
- 240
- 0
báo cáo hóa học: " Maximal COX-2 and ppRb expression in neurons occurs during early Braak stages prior to the maximal activation of astrocytes and microglia in Alzheimer''''s disease" pdf
Ngày tải lên :
19/06/2014, 22:20
... pathological disease state and investigated brain area, methods of analysis, as well as technical issues The data presented in this study are in agreement with the findings of Yermakova and O'Banion ... neuronal expression of COX-2 and ppRb during AD pathogenesis Staging of AD was neuropathologicallly evaluated according to Braak and Braak [18] Demographic characteristics of the cases used in this ... molecular pathologically defined events Cases with Braak stage A used in this study had either Braak stage I or II for neurofibrillary changes In Braak stage A for amyloid low densities of amyloid...
- 5
- 449
- 0
báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx
Ngày tải lên :
19/06/2014, 22:20
... humans, particularly at that stage of the disease when substantial fibrillar amyloid deposits have begun to accumulate [10] It is this stage of the disease that often correlates with appearance of ... per age per marker as noted in legends and text Quantitative comparisons were performed on sections processed at the same time Single ANOVA statistical analysis was used to assess the significance ... traditional image analysis approach Thus, this method is shown to accurately assess amyloid burden in transgenic mouse models of AD In addition, the use of object-based analysis provides data...
- 19
- 483
- 0