alzheimer΄s disease in a japanese population pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer ... pure In the lanes containing Ab(1–42) and Ab(M1– 42), there were prominent bands at approximately kDa and faint bands at approximately 14 kDa The band at approximately 14 kDa is not an impurity as...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Báo cáo y học: "Manifestations of Ollier’s disease in a 21-year-old man: a case report" pdf

Báo cáo y học: "Manifestations of Ollier’s disease in a 21-year-old man: a case report" pdf

... Chondromas are benign tumors of hyaline cartilage They may arise within the medullary cavity, where they are known as enchondromas In fact, enchondromas are the Case presentation A 21-year-old man ... activity involving the proximal and distal right femur and tibia, proximal right humerus, distal right ulna, right metacarpals, metatarsals and phalyngeal tubular bones, consistent with a unilateral ... humerus, ulna, femur, tibia, metacarpal, metatarsal and phalyngeal tubular bones, all located asymmetrically in the right side of the body most common cause of intraosseous cartilage tumors They are...

Ngày tải lên: 11/08/2014, 14:20

3 265 0
THE CLINICAL SPECTRUM  OF ALZHEIMER’S DISEASE – THE CHARGE TOWARD COMPREHENSIVE  pdf

THE CLINICAL SPECTRUM  OF ALZHEIMER’S DISEASE – THE CHARGE TOWARD COMPREHENSIVE  pdf

... Neuroimaging in the Spotlight 145 Chapter Currently Available Neuroimaging Approaches in Alzheimer Disease (AD) Early Diagnosis 147 Laura Ortiz-Terán, Juan MR Santos, Mar a de las Nieves Cabrera Martín ... Strain: A Useful Tool for Alzheimer’s Disease Research José Luis Albasanz, Carlos Alberto Castillo, Marta Barrachina, Isidre Ferrer and Mairena Martín 297 205 Contents Chapter 16 Valosin-Containing ... the majority of upregulated transcripts function in apoptotic and inflammatory pathways, including those involved in TNF alpha signaling and caspase pathways Using whole blood samples of AD patients...

Ngày tải lên: 28/06/2014, 05:20

376 377 0
Báo cáo y học: "Role of STAT4 polymorphisms in systemic lupus erythematosus in a Japanese population: a case-control association study of the STAT1-STAT4 region" pot

Báo cáo y học: "Role of STAT4 polymorphisms in systemic lupus erythematosus in a Japanese population: a case-control association study of the STAT1-STAT4 region" pot

... Tsukahara S, Kawaguchi Y, Terai C, Hara M, Tomatsu T, Yamanaka H, Horiuchi T, Tao K, Yasutomo K, Hamada D, Yasui N, Inoue H, Itakura M, Okamoto H, Kamatani N, Momohara S: Association of STAT4 with ... screening using Illumina GoldenGate assay (with AK), including tag SNP selection, genotyping, and statistical analysis JO carried out statistical analysis with AK and helped in the manuscript preparation ... necessary to examine Through comprehensive association analysis of the STAT1STAT4 region with SLE in the Japanese population, we demonstrated that the same STAT4 risk allele in Caucasians was strongly...

Ngày tải lên: 09/08/2014, 13:22

9 479 0
Báo cáo y học: " Synchronously diagnosed eosinophilic granuloma and Hodgkin''''s disease in a 12-year-old boy: a case report" pptx

Báo cáo y học: " Synchronously diagnosed eosinophilic granuloma and Hodgkin''''s disease in a 12-year-old boy: a case report" pptx

... disease; ABVD: adriamycin, bleomycin, vinblastine, dacarbazine; COPP: cyclophosphamide, concubine, procarbazine, prednisolone; ESR: Erythrocyte Sedimentation Rate; H&E: Hematoxylin and Eosin Competing ... Journal of Medical Case Reports 2009, 3:35 soft tissue In rare instances lesions have a permeative or moth-eaten appearance The median age for developing eosinophilic granuloma is 13 years Pain ... Ibarrola de Andres C, Toscano R, Lahuerta JJ, Martinez-Gonzalez MA: Simultaneous occurrence of Hodgkin's disease, nodal Langerhans' cell histiocytosis and multiple myeloma IgA(kappa) Virchows Arch...

Ngày tải lên: 11/08/2014, 19:21

4 203 0
Báo cáo y học: " Accidental Jorge Lobo''''s disease in a worker dealing with Lacazia loboi infected mice: a case report" doc

Báo cáo y học: " Accidental Jorge Lobo''''s disease in a worker dealing with Lacazia loboi infected mice: a case report" doc

... hand middle finger The patient did not recall any previous trauma in that particular anatomical area The nodule had appeared 10 months earlier as a small hard cutaneous swelling on the proximal ... For instance, a French aquarium caretaker developed the disease months after handling a L loboi infected dolphin [10] In contrast, in a man who apparently acquired the infection after traveling ... Venezuela, the lesion appeared two and a half years after his trip to the endemic area [11] A Canadian woman developed Jorge Lobo's disease year after she had been to Guyana and Venezuela [12] A bizarre...

Ngày tải lên: 11/08/2014, 20:20

5 266 0
Báo cáo y học: "Prevalence and clinical manifestations of gastro-oesophageal reflux-associated chronic cough in the Japanese population" pdf

Báo cáo y học: "Prevalence and clinical manifestations of gastro-oesophageal reflux-associated chronic cough in the Japanese population" pdf

... participated in acquisition of data HM participated in acquisition of data MJ participated in acquisition of data KC contributed to data interpretation MM contributed to data interpretation Acknowledgements ... positive gastroesophageal reflux disease in the Japanese Scand J Gastroenterol 2005, 40(9):1005-1009 Heading RC: Prevalence of upper gastrointestinal symptoms in the general population: a systematic ... manuscript AN conceived of the study, participated in its design, contributed to data interpretation MT participated in acquisition of data TU participated in acquisition of data MY participated...

Ngày tải lên: 13/08/2014, 08:20

4 223 0
Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc

Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc

... Although calpains may enhance caspase activity, they can also function to block the activation of caspases For example, calpains can cleave caspase rendering it incapable of activating caspase and ... suggested a possible cascade of events involving three protease systems: calpain-induced cathepsin release, cathepsin-mediated caspase activation and caspase-mediated calpastatin degradation leading ... translocation of calpain in the intermembrane space and AIF cleavage (tAIF) and release; (3) calpain-mediated Bcl-xL inactivation and cytochrome c release; (4) calpain-mediated p53 activation: p53 induces...

Ngày tải lên: 23/03/2014, 10:21

7 341 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf

Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf

... Cell viability was calculated by dividing the absorbance of wells containing samples by the absorbance of wells containing medium alone Statistical Analysis Statistical parameters (mean, standard ... carried out immunoassays (ELISA, Dot Blot, Neurotoxicity assay) He participated in analyses and interpretation of data He drafted the manuscript AG has been involved in analyses and interpretation ... inhibition assays DZ cloned, generated, and characterized chimeric viruses IP analyzed binding of antisera to A plaques in brain tissue from an AD case NM participated in immunization of mice and analyzed...

Ngày tải lên: 18/06/2014, 22:20

15 431 0
báo cáo hóa học: " Maximal COX-2 and ppRb expression in neurons occurs during early Braak stages prior to the maximal activation of astrocytes and microglia in Alzheimer''''s disease" pdf

báo cáo hóa học: " Maximal COX-2 and ppRb expression in neurons occurs during early Braak stages prior to the maximal activation of astrocytes and microglia in Alzheimer''''s disease" pdf

... pathogenesis Staging of AD was neuropathologicallly evaluated according to Braak and Braak [18] Demographic characteristics of the cases used in this study are shown in table For each case the area density ... mortem as well as in vivo studies indicate that microglial activation already occurs at an early stage in AD pathology [14,15] Cell cycle changes and increased neuronal COX-2 expression have also ... each Braak stage for neurofibrillary changes or amyloid deposits [18] (figure 1) All three markers show a gradual increase with increasing pathology Correlation analysis reveals a statistically...

Ngày tải lên: 19/06/2014, 22:20

5 450 0
báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx

báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx

... antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer's disease Proc Natl Acad Sci U S A 2001, 98:8850-8855 Bacskai BJ, Kajdasz ST, McLellan ... immunized animals relative to the adjuvant control animals, and was nearly identical to that seen in similar brain sections of animals immunized with oligo A C3 staining in animals immunized at 16–20 ... KS300 analysis program (Zeiss) Percentage of immunostained area (area of immunostaining/total image area × 100) was Page of 19 (page number not for citation purposes) Journal of Neuroinflammation...

Ngày tải lên: 19/06/2014, 22:20

19 483 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... Helkala EL, Laakso MP, Hanninen T, Hallikainen M, Alhainen K, Soininen H, Tuomilehto J, Nissinen A: Midlife vascular risk factors and Alzheimer's disease in later life: longitudinal, population ... protein kinase inhibitors revealing that protein kinase C (PKC) [37-39], p21-activated kinase-1 (PAK1) [40], mitogen-activated protein kinase (MAPK) [41], Akt [42], and phosphatidylinositol3 kinase...

Ngày tải lên: 19/06/2014, 22:20

12 413 0
báo cáo hóa học: " Neuroinflammation in Alzheimer’s disease wanes with age" pdf

báo cáo hóa học: " Neuroinflammation in Alzheimer’s disease wanes with age" pdf

... inflammation in the brain Some studies have suggested that aging facilitates an imbalance between pro- and anti-inflammatory mechanisms resulting in a low grade, chronic pro-inflammatory status, ... cerebral atrophy in AD [9,10] These data indicate that neuroinflammation is involved at an early stage of AD pathogenesis It has recently been proposed that aging has an effect on the function of inflammation ... tomography and the peripheral benzodiazepine ligand PK11195 as a marker for activated microglia indicate that activation of microglia occurs already in mild and early forms of AD-type dementia and...

Ngày tải lên: 19/06/2014, 22:20

8 337 0
Báo cáo y học: "ITGAV polymorphism and disease susceptibility in a Japanese rheumatoid arthritis population" ppsx

Báo cáo y học: "ITGAV polymorphism and disease susceptibility in a Japanese rheumatoid arthritis population" ppsx

... Iwamoto T, Ikari K, Inoue E, Toyama Y, Hara M, Yamanaka H, Tomatsu T, Momohara S, Kamatani N: Failure to confirm association between PDCD1 polymorphisms and rheumatoid arthritis in a Japanese population ... Migliorini P, Balsa A, Westhovens R, Barrera P, Alves H, et al.: The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study Arthritis ... to below 0.8, and this may represent a study limitation Despite its association with RA in Caucasian populations, an association of the ITGAV gene with RA patients in the Japanese was not observed...

Ngày tải lên: 09/08/2014, 10:21

2 313 0
Báo cáo y học: "Fish-on-a-chip: a sensitive detection microfluidic system for alzheimer’s disease" pdf

Báo cáo y học: "Fish-on-a-chip: a sensitive detection microfluidic system for alzheimer’s disease" pdf

... blood and urine samples instead Page of 11 Recently, Ivan and colleagues reported that human brain diseases such as AD, which are present in the human brain and are associated with chromosomal disorders ... elegans and cell imaging P Natl Acad Sci USA 2008, 105:10670-10675 97 Hatakeyama K, Tanaka T, Sawaguchi M, Iwadate A, Mizutani Y, Sasaki K, Tateishi N, Matsunaga T: Microfluidic device using chemiluminescence ... 27:3297-3305 Yamaguchi Y, Ogura D, Yamashita K, Miyazaki M, Nakamura H, Maeda H: A method for DNA detection in a microchannel: Fluid dynamics Phenomena and optimization of microchannel structure Talanta...

Ngày tải lên: 10/08/2014, 05:21

11 512 0
Tài liệu Báo cáo khoa học: Animal models of amyloid-b-related pathologies in Alzheimer’s disease docx

Tài liệu Báo cáo khoa học: Animal models of amyloid-b-related pathologies in Alzheimer’s disease docx

... of an animal model in the same laboratory Conventional tests are also time-consuming and greatly in uenced by individual handlers IntelliCages are automated learning cages where animals carrying ... release of Ab and anterograde axonal transport of APP [108,109] Senile plaque formation can also be induced in APP transgenic mice if Ab-containing brain extracts from plaque-laden mice or AD brain ... Cummins DJ, Dodart JC, Paul SM & Holtzman DM (2001) Peripheral anti -A beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer’s disease...

Ngày tải lên: 16/02/2014, 09:20

21 560 0
Memory performance in healthy elderly without Alzheimer’s disease: effects of time and apolipoprotein-E pptx

Memory performance in healthy elderly without Alzheimer’s disease: effects of time and apolipoprotein-E pptx

... than 10 years of education, the APOE-␧4 allele*time interaction remained statistically significant indicating that memory declined at a faster rate among individuals with an APOE-␧4 allele compared ... follow-up and both age and education as independent variables The use of generalized estimated equations to evaluate the longitudinal data set is an added technical advantage because this statistical ... Please note The cut-off for inclusion was 0.5; items included within a specific factor are shown in gray mance for each individual and the majority, 67%, had a slope less than indicating a decline...

Ngày tải lên: 05/03/2014, 21:20

7 474 0
PET in the Evaluation of Alzheimer’s Disease and Related Disorders docx

PET in the Evaluation of Alzheimer’s Disease and Related Disorders docx

... software tools can be employed to assist with analysis, and then illustrates a straightforward approach for integrating the qualitative and quantitative findings in meaningful interpretations An Atlas ... whereas in vascular or mixed dementia (vascular plus AD) focal motor or sensory signs (excluding fluent aphasia and apraxia) may be present.54 Parkinsonian rigidity and bradykinesia accompanying ... visual assessment, and then examines methods of regional quantification that are practical in typical clinical environments, and, finally, illustrates an approach toward scan interpretation that...

Ngày tải lên: 05/03/2014, 23:20

231 535 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... deficiency in AD may involve Ab and APP Ab and its precursor APP both bind Cu, and over-expression of a C-terminal fragment of APP or full length APP, both containing the Ab domain, results in an overall ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... the AD brain is intracellular Cu Insufficient intracellular Cu can contribute to an increase in oxidative stress (described above), and several lines of evidence indicate that intracellular Cu...

Ngày tải lên: 07/03/2014, 10:20

9 634 0
Báo cáo khoa học: RCAN1-1L is overexpressed in neurons of Alzheimer’s disease patients pot

Báo cáo khoa học: RCAN1-1L is overexpressed in neurons of Alzheimer’s disease patients pot

... alone LA RT-PCR was performed using a kit from Tamara Shuzo (TaKaRa Bio Inc.) and conditions had been adjusted to ensure that results were in a linear range and that a plateau had not been reached ... immunohistochemistry and enzyme-immunoassay Brain Res 397, 161–172 15 Kuno T, Mukai H, Ito A, Chang CD, Kishima K, Saito N & Tanaka C (1992) Distinct cellular expression of calcineurin A alpha and A beta in rat ... to bind to and inhibit the serine–threonine protein phosphatase calcineurin [5] The brain is an especially interesting organ in which to examine RCAN1 expression, because calcineurin is highly...

Ngày tải lên: 16/03/2014, 11:20

10 302 0
w