allele+gstm1+0+as+a+possible+risk+factor+for+recurrent+pregnancy+loss

... rs9 804 1 90 (C/T) 400 4 80 0.618 0. 578 0. 237 0. 327 0. 3 80 0. 101 0. 056 0. 042 0. 337 rs 109 94336 (C/T) 400 4 80 0.843 0. 874 0. 182 0. 154 0. 119 0. 13 0. 003 0. 006 0. 415 rs 107 61482 (C/T) 400 4 80 0.652 0. 572 0. 015 ... 0. 572 0. 015 0. 300 0. 359 0. 063 0. 048 0. 069 0. 19 P: test for association (FAMHAP); CC, CT, TT: genotypes Sample was further differentiated according to Leonhard’s classification Analyzing association ... Cases Controls SNP n n CC CC P CT CT P TT TT P rs9 804 1 90 (C/T) rs 109 94336 (C/T) 9 20 9 20 4 80 4 80 0.577 0. 884 0. 578 0. 874 0. 949 0. 617 0. 369 0. 112 0. 3 80 0.119 0. 674 0. 689 0. 055 0. 004 0. 042 0. 006 ...

Ngày tải lên: 11/08/2014, 15:22

... alkylating agents Tamoxifen sensitivity Metastasis Metastasis Metastasis Metastasis Ref Ferguson, 200 0 Gasco, 200 2 Agirre, 200 6 Burns, 200 3 Syed, 200 6 Scolnick, 200 0 Corn, 1999 Taniguchi, 200 3 ... 5’ ATGACCAGTCAACAGGGGAC 3’ 5’ CCAGCAAGCTTGCGACCTTGACCA 3’ 192 GW-CRH-BP-f 5’ AAA AAG CAG GCT CCA GCA TGT CGC CCA ACT TC 3’ GW-CRH-BP-r 5’ AGA AAG CTG GGT AAA GAC CAG ACA AAC AGA ATT C 3’ - Table ... Teodoridis, 200 5 Soengas 200 1 Gifford, 200 4 Teodoridis, 200 5 Esteller, 200 0, 200 2 Chang, 200 5 Domann, 200 0 Graff, 1998, 200 0 Sato, 200 6 Sato, 200 6 Table 1.Genes methylated in cancer cells that may have...

Ngày tải lên: 04/10/2015, 08:00

... fetal small parts: a case report J Reprod Med 201 0, 55(9- 10) :437-4 40 Coulier B, Maldague P, Broze B: Gastric ulcer penetrating the anterior abdominal wall: ultrasound diagnosis Abdom Imaging 200 3, ... cesarean: a case series and review of the literature Am J Perinatol 200 9, 26( 10) :739-744 Kurdoglu M, Kolusari A, Yildizhan R, Adali E, Sahin HG: Delayed diagnosis of an atypical rupture of an ... 201 1 References Gupta A, Nanda S: Uterine rupture in pregnancy: a five-year study Arch Gynecol Obstet 201 1, 283(3):437-441 Morimatsu Y, Matsubara S, Higashiyama N, Kuwata T, Ohkuchi A, Izumi A, ...

Ngày tải lên: 10/08/2014, 23:20

... significant associations have been found between ETS for respiratory diseases such as adult and pediatric asthma Also a series of epidemiological analyses on parental smoking and respiratory health ... 60 61 62 63 Hara J, Fujimura M, Myou S, Oribe Y, Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough ... linear trend < 0. 05, ** < 0. 005 , < 0. 000 1 Odds ratios were adjusted for age, alcohol consumption, body mass index, diabetes, ethnicity, education status, hypertension, marital status, physical activity...

Ngày tải lên: 13/08/2014, 08:20

... investigator All NSAIDs and aspirin were considered However, when aspirin was taken as an antiplatelet aggregant for the prevention of cardiovascular diseases (

Ngày tải lên: 13/08/2014, 16:20

... Network Load Balancing provides a greater benefit than round robin DNS entries because Network Load Balancing automatically excludes servers that are unavailable You can enhance the availability for ... Server as LAN interfaces are persistent, and the data rate is determined by the LAN technology Public network segments that appear as demand-dial interfaces are nonpersistent, and the data rate ... proxyarray.msft IN proxyarray.msft IN proxyarray.msft IN A A A 10. 0 .0. 1 10. 0 .0. 2 10. 0 .0. 3 When a query is made for the proxy array, the DNS server responds in a round robin order of the IP addresses In...

Ngày tải lên: 18/10/2013, 18:15

... to paternal age In fact, as advanced paternal age was a risk factor for schizophrenia, the disease frequency was greater in children with higher birth rank as well (that is, higher paternal age) ... disease to focus on genetic approaches Table Sample classes as a function of parental or maternal age at birth Group Parental age at birth, n (%) Paternal Total (P = 0. 065) Maternal

Ngày tải lên: 09/08/2014, 01:21

... respectively; P = 0. 06) Also, history of diabetes (risk ratio = 1.9; P = 0. 05) and age is associated with an increase in risk of death (risk ratio per year age increase = 1 .07 ; P < 0. 001 ) Survival plots ... Adjusted ORa(95% CI) P 1.73 (1 .03 , 2.91) Variable 0. 04 1.97 (1.15, 3.36) 0. 01 History of hyperlipidemia NA NA 2.56 (1.35, 4.85) 0. 004 Age (per year increase) NA NA 1 .05 (1 .02 , 1 .07 ) 0. 002 Sex (female ... to death, a Cox model was fit for each of the other baseline variables Kaplan-Meier survival plots were constructed for time to death as a function of each baseline variable Statistical analyses...

Ngày tải lên: 09/08/2014, 06:23

... Maruyama K, Sasako M, Kinoshita T, Sano T, Katai H, Okajima K: Pancreas-preserving total gastrectomy for proximal gastric cancer World J Surg 1995, 19:532-536 Sasako M, Katai H, Sano T, Maruyama K: ... intraabdominal complication such as anastomotic leakage or POPF In case of having intraabdominal infectious complication, we changed drains under radiographic examination and lavaged the cavity ... the outcome of gastric carcinoma patients Oncology 200 0, 59:18-23 Tsujinaka T, Sasako M, Yamamoto S, Sano T, Kurokawa Y, Nashimoto A, Kurita A, Katai H, Shimizu T, Furukawa H, et al.: Influence...

Ngày tải lên: 09/08/2014, 07:21

... Taniguchi N, Kawahara K, Yone K, Hashiguchi T, Yamakuchi M, Goto M, Inoue K, Yamada S, Ijiri K, Matsunaga S, Nakajima T, Komiya S, Maruyama I: High mobility group box chromosomal protein plays a role ... in human monocytes J Exp Med 200 0, 192:565-5 70 Wang H, Bloom O, Zhang M, Vishnubhakat JM, Ombrellino M, Che J, Frazier A, Yang H, Ivanova S, Borovikova L, Manogue KR, Faist E, Abraham E, Andersson ... AR, GallowitschPuerta M, Patel NB, Huston BJ, Chavan S, Rosas-Ballina M, Gregersen PK, Czura CJ, Sloan RP, Sama AE, Tracey KJ: Cholinergic anti-inflammatory pathway activity and high mobility group...

Ngày tải lên: 09/08/2014, 10:23

... infection after coronary artery bypass graft operation (CABG): a case report J Cardiothorac Surg 200 9, 4:47 Weis F, Beiras-Fernandez A, Kaczmarek I, Sodian R, Vicol C, Reichart B, Weis M: Daptomycin for ... colonization and infection with MRSA Standard therapy concerning antibiotic treatment has failed to eradicate the MRSA, so that we decided for an alternative antimicrobial strategy in the form of Daptomycin ... Germany) Daptomycin (4 mg/kg/day) was administered and total duration of application was ten days The wound eventually healed with no residual fistula or infection of MRSA (Figure 2) and she was...

Ngày tải lên: 10/08/2014, 09:22

... Compostela University Hospital La Choupana, Santiago de Compostela 15 706 , Spain 2Department of Radiology, Santiago de Compostela University Hospital La Choupana, Santiago de Compostela 15 706 , Spain ... et al.: Is distortion of the bioprosthesis ring a risk factor for early calcification? Journal of Cardiothoracic Surgery 201 0 5:77 Author details Department of Cardiovascular Surgery, Santiago ... ring Liao KK, Li X, Ranjit J, Amayta DM, Joyce LD, Park SJ, Bianco R, Bolman RM: Mechanical stress: An independent determinant of early bioprosthetic calcification in humans Ann Thorac Surg 200 8,...

Ngày tải lên: 10/08/2014, 09:22

... embolism was found to be caused by hypoplasia of her inferior vena cava, with a bilateral occlusion of her vena iliaca communis A diagnostic evaluation showed that a collateral pathway with ectatic ... vena cava lead to significantly better results [11] This is not always possible where there is hypoplasia and/or aplasia of the inferior vena cava, so, as in our patient’s case, only symptomatic ... vena cava and bilateral deep venous thrombosis Spine (Phila Pa 1976) 200 7, 32: E688-E691 Hanley EN, Howard BH, Brigham CD, Chapman TM, Guilford WB, Coumas JM: Lumbar epidural varix as a cause...

Ngày tải lên: 10/08/2014, 22:20

... Oral Maxillofac Surg 200 3, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... http://www.jmedicalcasereports.com/content/5/1/477 Page of Figure a) intraoral examination of her left lower jaw with fistula formation and pus on palpation in region 38; b) panoramic radiograph with mixed radiopaque and radiolucent areas surrounding ... 69(1):84-91 Sambrook P, Cooper C: Osteoporosis Lancet 200 6, 67(9527): 201 0- 201 8 Ruggiero SL, Dodson TB, Assael LA, Landesberg R, Marx RE, Mehrotra B: American Association of Oral and Maxillofacial Surgeons...

Ngày tải lên: 10/08/2014, 23:20

... popliteal artery Ann Surg 1979, 189:165-175 Cassar K, Engeset J: Cystic adventitial disease: a trap for the unwary Eur J Vasc Endovasc Surg 200 5, 29:93-96 Motaganahalli RL, Pennell RC, Mantese VA, ... treatment with percutaneous transluminal angioplasty Vasc Endovascular Surg 200 9, 43(4):399- 402 Taurino M, Rizzo L, Stella N, Mastroddi M, Conteduca F, Maggiore C, Faraglia V: Doppler ultrasonography ... 10 Rai S, Davies RS, Vohra RK: Failure of endovascular stenting for popliteal cystic disease Ann Vasc Surg 200 9, 23(3):4 10 11 Maged IM, Kron IL, Hagspiel KD: Recurrent cystic adventitial disease...

Ngày tải lên: 11/08/2014, 12:20

... alanine aminotransferase (ALAT, 1 20 U/L), gamma-glutamyl transferase (ү-GT, 2 40 U/L) and bilirubin (27 μmol/L) A test for malaria was negative Lumbar puncture, chest X-ray and abdominal ultrasound ... such as case clustering within well-demarcated geographical areas and an increased risk of recurrence after liver transplantation with increasing immunosuppression [ 10] Escherichia coli, atypical ... (ALAT 60 U/L, ү-GT 179 U/L) and antibody titers against Coxiella burnetii (phase I: IgG, 800 ; IgA, 0; IgM, 0; phase II: IgG, 1 600 ; IgA, 0; IgM, 0) within months of therapy (Figure 1) In May 200 6,...

Ngày tải lên: 11/08/2014, 14:20

... chemical compounds Crit Rev Toxicol 200 6, 36: 609 -662 Kaufmann T, Bloch C, Schmidt W, Jonas L: Chronic inflammation and pain inside the mandibular jaw and a 10- year forgotten amalgam filling in an alveolar ... the biochemical and clinical data GG performed the endo-oral X-ray and managed the patient MEF had the original idea and wrote the paper All authors have read and approved the final manuscript Consent ... palpitations, headache and sporadic chest pain on the left side Two days later she developed a high temperature (39.1°C) which lasted day and night for three whole days and which was associated...

Ngày tải lên: 11/08/2014, 23:21

... prophylaxis Propofol 8 60 mgs and Fentanyl 300 0 micrograms were given as an infusion during and after the operation Ketamine 600 mgs was administered via intravenous infusions for analgesia The ... Journal of Medical Case Reports 200 8, 2:1 40 At the time of operation he received 20 ml 0. 5% Bupivacaine with adrenaline for local anaesthesia with g Cephalothin administered for antibiotic ... cholangiopancreatography confirmed the presence of gallstones but was otherwise unremarkable with no ductal dilatation A liver biopsy was performed and was striking for the presence of canalicular...

Ngày tải lên: 11/08/2014, 23:21

... http://ccforum.com/content/8/6/R437 Table Multivariate analysis of length of stay Prognostic variable β SE of β P Duration of surgery 0. 062 0. 021 0. 004 BMI 0. 0 10 0 .00 6 0. 072 Mean postoperative glucose 0. 024 0. 018 0. 195 History ... SE of β = 0. 006 ) and history of cardiac valve disease or arrhythmia (P = 0. 103 ; β = 0. 1 30; SE of β = 0. 079) After correction for these variables in multivariate analysis, mean postoperative glucose ... undergone cardiovascular bypass surgery and peripheral vascular surgery [12-16] Few patients in our cohort suffered from (cardio)vascular disease because ASA class or was a prerequisite for inclusion...

Ngày tải lên: 12/08/2014, 20:20

... Risk factor 0. 98 0. 54–1.79 >0. 9 Hospital-acquired pneumonia 1 .0 0.46–2.18 >0. 9 Operation 5 days 1.91 1. 10 3.34 0. 022 (6.8– 10)

Ngày tải lên: 12/08/2014, 23:23