all pigs from a pseudorabies monitored vaccinated feeder pig herd that are transported to a remote growout nursery must be progeny of sows which have been vaccinated with a single official gene altered pseudorabies vaccine
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
Ngày tải lên :
19/02/2014, 16:20
... Number of hydrogen bonds Main chain–main chain Main chain–side chain Side chain–side chain Total ˚ Exposed surface areab (A2 ) ˚ Apolarc (A2 ) ˚ Buried surface areab (A2 ) ˚ Apolarc (A2 ) a 1IC6 ... whereas the overall exposed surface areas of the psychro- and the mesophilic enzymes are larger than for the thermophile enzyme, mainly as a result of larger area of apolar atoms, the meso- and ... increase in nonpolar surface area have been suggested as relevant in the adaptation to low temperatures [8,12,14,15,52] In citrate synthases adapted to different temperatures a clear trend was...
- 14
- 597
- 0
Báo cáo hóa học: " Cellulose fibres, nanofibrils and microfibrils: The morphological sequence of MFC components from a plant physiology and fibre technology point of view" pptx
Ngày tải lên :
21/06/2014, 03:20
... primary wall (P) and several secondary wall layers (S1, S2 and S3) Each of these layers is Page of characterised by a specific arrangement of fibrils as has been detailed described for more than ... Structures with diameters of
- 7
- 569
- 0
Tài liệu Turn Down the Heat - Why a 4C warmer world must be avoided doc
Ngày tải lên :
16/02/2014, 11:20
... levels at which waters become undersaturated with respect to aragonite have become shallower when compared to preindustrial levels Aragonite saturation depths have been calculated to be 100 to 200 ... Vietnam, and parts of the African coast Sea-level rise would likely impact many mid-latitude coastal areas and increase seawater penetration into coastal aquifers used for irrigation of coastal ... Australia: Large negative effects of a “surprising” dimension have been found in Australia for regional warming variations of +2°C, which Asseng, Foster, and Turner argue have general applicability...
- 106
- 307
- 0
How to setup a Linux system that can boot directly from a software RAID
Ngày tải lên :
18/09/2012, 10:11
... the partitioning utility to create the software RAID partitions In the example both disks are split into a 3498Mb and a 596Mb software RAID partitions: Device Type Size Mbytes /dev/hda1 software ... boot loader: Once the configuration installation options are provides, the installation of the system starts: Notice that while the system is installing, the software RAID transparently initializes ... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software...
- 14
- 567
- 1
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf
Ngày tải lên :
21/09/2012, 17:33
... today most advantages don’t stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another ... Banks had to make changes with the advent of automated teller machines (ATMs), and major airlines have to make changes with the new competition coming from low-fare airlines Jack Welch at GE admonished ... price, and so on It is more often some unique combination of these, rather than a single silver bullet, that delivers the advantage A great company will have incorporated a set of advantages that all...
- 226
- 1.4K
- 7
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
Ngày tải lên :
23/09/2012, 15:38
... that out of 400 tons of medical wastes, there are 50 tons that are dangerous and non-recyclable This means that about 87% of medical wastes can be recycled without harming the community’s health ... regulations There have been many sanitation workers dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and ... such as refrigerators The lid on the containers should be leak-proof and unable to be punctured, and the container should be labeled appropriately and indicated to be a biohazard material” etc...
- 10
- 722
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
Ngày tải lên :
03/11/2012, 11:44
... Male AVNRT AVRT EAT From symptom to diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily ... results of RF ablation So far, QoL before and after ablation has not been systematically investigated in these patients (7-13) In contrast, other SVT like atrial flutter and AF have been intensively...
- 9
- 679
- 0
A visit from a pen pal
Ngày tải lên :
17/01/2013, 09:58
... (n): phân chia; phép chia region (n): vùng; miền -» regional (adj): thuộc vùng; đ a phương to separate (v): ngăn cách; tách ra; chia Ex: Their yard is separated from the factory by a tall fence ... www.videobook.vn official (adj): thức Ex: There will be an official investigation into last week’s accident (Sẽ có điều tra thức tai nạn tuần trước) Buddhism (n): đạo Phật —> Buddhist (adj): thuộc ... been a place of worship since the eighth century (T a nhà trở thành nơi thờ phụng từ kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association of South East Asian Nations:...
- 5
- 1.7K
- 0
English Proverbs from A to Z
Ngày tải lên :
18/06/2013, 01:26
... saddle than the horse It's better to stop and accept a small loss, rather than continue and risk losing everything Better untaught than ill-taught It's better not to be taught at all than to be ... eye of the beholder Different people have different tastes Beauty is the wisdom of women Wisdom is the beauty of men Be swift to hear, slow to speak Listen carefully before speaking Better be alone ... It's better to deal with somebody difficult but familiar, than change and risk dealing with somebody worse Better late than never It's better to something, even if it's late, than not it at all Better...
- 5
- 624
- 1
Unit 1: A visit from a pen pal
Ngày tải lên :
21/06/2013, 01:27
... Date of teaching: September 20th, 2006 Period: 06 Activity were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past subjunctive + Ask students to look at the ... students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I lived close to school d) I wish I ... d) I wish I drew well + Let students make three wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn by heart the structures Remarks ...
- 2
- 1.1K
- 0
Unit 1: A visit from a pen pal
Ngày tải lên :
21/06/2013, 01:27
... The past simple with wish + Give example and explain the way to use Ex : a You are a student ( I wish I were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past ... - Lang Biang Mountain / blimbing - Xuan Huong Lake / walk around - Valley of Love / sightseeing A : I think I’ll take my friends to ………….We can …… B : Good ideas ! I believe they will be interested ... subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I lived close to school...
- 3
- 933
- 0
Unit 1_ A visit from a penpal
Ngày tải lên :
26/06/2013, 01:27
... her pen-pal, Maryam have _ two years Created by TTM_titiempi Date: Name: _ English 9_ Unit It seems very difficult to me to have a trip abroad Having a trip ... country? The cancer patient _to God for an end to her sufferings 10 I don’t want to _too much on my parents 11 The unit of _of Lao is kip 12 Are you still in _with your ... Date: Name: _ English 9_ Unit Fill in each blank with one suitable word: Japan _four main islands Hokkaido, Honshu, Shikoku, and Kyushu A Japanese lunch is a light...
- 4
- 552
- 0
Techical analysis from a to z
Ngày tải lên :
13/08/2013, 15:59
... Armed with the above knowledge and well aware of the myriad of technical analysis books that are already available, I feel there is a genuine need for a concise book on technical analysis that ... quickly that anything written today becomes incomplete (but not obsolete) tomorrow Armed with the above knowledge and well aware of the myriad of technical analysis books that are already available, ... http://www.ics.forth.gr/~asidirop/AsidiropSoft/TechnicalAnalysis2/free/taaz/intmovingaverages.html Page 24 Introduction, Indicators - Technical Analysis from A to Z 01/09/1999 INTRODUCTION - Indicators Indicators An indicator is a mathematical calculation that can be applied...
- 227
- 662
- 0
Marketing insights from a to z 80 concepts every manager needs to know
Ngày tải lên :
15/08/2013, 14:09
... today most advantages don’t stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another ... Banks had to make changes with the advent of automated teller machines (ATMs), and major airlines have to make changes with the new competition coming from low-fare airlines Jack Welch at GE admonished ... price, and so on It is more often some unique combination of these, rather than a single silver bullet, that delivers the advantage A great company will have incorporated a set of advantages that all...
- 226
- 735
- 0
Evaluation of Nutrient Loads from a Citrus Orchard in Japan
Ngày tải lên :
05/09/2013, 10:15
... showed that the Case evaluation gave a higher discharge than in Case Kunimatsu et al (2006) calculated cv (coefficient of variation) values of the annual loads in Mano River (watershed area of 16.4 ... of TP was avoided in this study Evaluation of phosphorus loads will require the establishment of a seasonally separated equation model that takes into account rainfall events and seasonal changes ... calculated from the data of weekly (7-days interval) observation were 0.54 for total nitrogen and 0.74 for total phosphorus, and that of discharge was 0.23 They designated that the annual loads calculated...
- 10
- 425
- 0
Nutrient Loss from a Tea Plantation Area in Japan
Ngày tải lên :
05/09/2013, 10:15
... than 60 years ago The total area of watershed at the sampling point is 41.5ha, including the area of 4.5ha of tea fields The major bedrock at the area is granite The watershed of the upstream ... forest and no wastewater drainage is linked to the river Vegetative stage of tea trees is normally between March and October in this area According to a guideline for farmers on annual plan of tea ... stable As a result, the annual discharge of nitrogen and phosphorus from the tea plantation area were estimated to be 535kgN/ha/year and 21kgP/ha/year, respectively, indicating that the tea plantation...
- 10
- 344
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
Ngày tải lên :
05/09/2013, 10:15
... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities...
- 9
- 522
- 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
Ngày tải lên :
05/09/2013, 16:10
... introduced before, which are made of ceramic material, another device mainly made of wet textile band has been designed, manufactured and characterised It is basically a cotton band of 25 cm width and ... the air reaches its saturated state, when the air and water temperature reach the same value, called “adiabatic saturation temperature”, being the process known as “adiabatic saturation” To define ... (20 %) to describe which would be the theoretical cooling level that would be achieved in an ideal adiabatic saturation process It can be noticed that the maximum temperature that can be achieved,...
- 28
- 652
- 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
Ngày tải lên :
05/09/2013, 16:11
... generation rate, k and potential methane generation capacity, Lo Emission type Landfill type CAA Conventional CAA Arid area Inventory Conventional Inventory Arid area Inventory Wet (bioreactor) Source: ... (mg/year) [11] Also, when calculating the value of Mi as can be seen in equation 1.0, the mass of non-degradable solid waste should be subtracted from the total mass of solid waste in a particular ... calculation of NMOC emission are highly variable, there is an accompanying realisation that the deterministic outcome which is a single value would be unrepresentative of the total annual mass...
- 8
- 540
- 0