alkylation in a position
Socioeconomic position and health in a population of Brazilian elderly: the Bambuí Health and Aging Study (BHAS) pdf
Ngày tải lên :
14/03/2014, 20:20
... (puntuación en el Cuestionario General de Salud, autovaloración del estado de salud y de la agudeza visual, grado de dificultad para caminar 300 metros, incapacidad para realizar las actividades ... reliability of the data gathered, standardizing procedures and instruments, training of field-work and labo- ratory teams, and adjusting for several confounding variables Internal validity was assured ... appointment because of existing lines, and in obtaining medicines because of financial problems or any other problem (Table 4) ple, in China and India, higher income levels, particularly in urban...
- 8
- 735
- 0
Investing in Nursing Education to Advance Global Health: A position of the Global Alliance for Leadership in Nursing Education and Science pptx
Ngày tải lên :
14/03/2014, 21:20
... job market, graduates of baccalaureate nursing programs are securing positions at a significantly higher rate than the national average In August 2010, AACN conducted an online survey of nursing ... American Association of Colleges of Nursing (2011) 2010-2011 Enrollment and graduations in baccalaureate and graduate programs in nursing Washington, DC: Author Australian Institute of Health and ... growth in these programs Early findings also point to an impressive 21.6% growth in enrollments in RN-to-baccalaureate programs, a 10.8% increase in master’s programs, a 10.4% increase in research-focused...
- 6
- 562
- 0
Gender inequality in health among elderly people in a combined framework of socioeconomic position, family characteristics and social support doc
Ngày tải lên :
22/03/2014, 14:20
... two indicators: educational attainment and material deprivation Educational attainment was generated by collapsing some categories of the original variable because of the few individuals in some ... variables measuring household material standards and generated by combining the following five items : having a shower and/or a bath, having hot running water, having central or dispersed heating, ... Silvia Rueda and Luc a Artazcoz Ferraro, K and Famer, M 1996 Double jeopardy Aging as leveler, or persistant health inequality ? A longitudinal analysis of white and black Americans Journal of...
- 23
- 420
- 0
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
Ngày tải lên :
28/03/2014, 23:20
... unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by ... proteins, a family of proteins containing one or two RNA-binding domains and a signature RS domain rich in Arg ⁄ Ser dipeptides, and splicing silencers usually recruit heterogeneous nuclear RNPs, a set ... structured RNA in HBV genome regulates alternative splicing The HBV genome harbors multiple S-AS splicing silencers HBV genes are compacted in its small genome To maintain intact reading frames of...
- 14
- 379
- 0
Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions
Ngày tải lên :
08/10/2014, 16:46
... ………… A his mistakes being laughed at B laughing his mistakes at C his mistakes laughing at D his mistakes at laughing Question 47: I can’t go with you today; I have…………… things to A a great deal ... American Indians across North America C Ceremonies and rituals of American Indians D The way of life of American Indian tribes in early North America Question 72 According to the passage, the Hopi and ... Mountains and the Pacific Ocean They gathered seeds and hunted small animals such as rabbits and snakes In the Far North, the ancestors of today’s Inuit hunted seals, walruses, and the great whales...
- 13
- 3.6K
- 0
Mark the letter a b c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions
Ngày tải lên :
08/10/2014, 16:46
... started complaining D As soon as the announcement was made, everyone started complaining Question 45 : Jenny is so creative that we all can rely on her for original ideas A Being creative, we all ... announcement was made A No sooner did everyone start complaining than the announcement was made B Everyone started complaining that the announcement was made C No sooner had the announcement made than everyone ... are so widespread in all cultures that there seems to be a physical basis for them All people react in the same way to certain exciting situations by breathing more rapidly and experiencing increased...
- 15
- 4.2K
- 0
The Position and role of small and medium enterprises in a national economy – the case of Japan
Ngày tải lên :
01/11/2014, 22:05
... rank three: Okinawa, Miyazaki and Nagasaki Japan consists of 47 prefectures) by using statistical data on the size of the enterprise and prefectural income (typical index that measure the wealth ... Structure, The Ministry of Health, Labour and Welfare) This means that SMEs have played an important and constant role in employment and have a significant role in social issues Japan is often called “The ... improvement and personnel training for SMEs A pro-active method of planning and preparations in the design and development phase promotes close sharing, cooperation, and information between the parent...
- 31
- 743
- 0
Multithreaded Programming in a Microsoft Win32* Environment
Ngày tải lên :
12/09/2012, 14:40
... doing something, the other threads can handle the user inputs and perform the tasks For example, if a user wants to cancel bringing in a large amount of data from a web page, a single threaded ... running at a higher priority can immediately react and cancel the operation When Not to Use Threads… Using multiple threads in an application does not guarantee any kind of a performance gain ... constantly interacting with the program, are independent activities The performance of an application can be improved by creating a separate thread for performing each of these activities rather...
- 14
- 794
- 1
Báo cáo y học: "Emergency intraosseous access in a helicopter emergency medical service: a retrospective study"
Ngày tải lên :
25/10/2012, 10:02
... and coordination, and in drafting the manuscript BEH participated in the design of the study and the statistical analysis, and participated in drafting the manuscript BHV participated in the design ... HEMS training programme, intraosseous training was given using manual needles, Bone Injection Guns, and EZ-IO® on both manikins and cadavers All HEMS physicians have used the technique on patients ... study, and the drafting of the manuscript and tables and figures All authors have read and approved the final manuscript Competing interests The authors declare that they have no competing interests...
- 5
- 559
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
Ngày tải lên :
25/10/2012, 10:06
... such as endoscopy [66-72] Non-cardiac chest pain, defined most simply as recurrent episodes of unexplained retrosternal pain in patients lacking a cardiac abnormality after a reasonable evaluation, ... chest pain In order for chiropractors to have a role in managing chest pain from the point of entry, they must acquire and demonstrate competence in diagnosing the complaint Chest pain can have a ... chest pain, whether as a main presenting complaint or as a co-morbid condition The prevalence and clinical management, both diagnosis and treatment, of musculoskeletal chest pain in ambulatory...
- 10
- 788
- 0
Báo cáo y học: "Users' guides to the medical literature: how to use an article about mortality in a humanitarian emergency"
Ngày tải lên :
25/10/2012, 10:31
... Relief-Web (a media and NGO repository maintained by the Office for the Coordination of Humanitarian Affairs), the Uppsala Conflict Database Program (a database that contains information on armed conflicts ... census data that can provide region-specific demographic and mortality data However, in many settings affected by conflict, populations are displaced, census data is out-of-date and Health Information ... death certificates Death certificates may vary in quality; some provide specific causes of death, others not In many settings lacking infrastructure, particularly among displaced populations, authorities...
- 9
- 694
- 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"
Ngày tải lên :
25/10/2012, 10:35
... data analysis and interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and CC participated in the study design, data acquisition and drafting of the manuscript ... peak plasma creatinine > 2.5 mg/dl, Peak plasma urea nitrogen > 60 mg/dl, dialysis or continuous venovenous haemofiltration Table Causes of mortality in the patient group Variable Standard treatment ... manuscript All authors read and approved the final manuscript Available online http://ccforum.com/content/12/5/R120 Additional files The following Additional files are available online: Additional file...
- 9
- 635
- 0
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
Ngày tải lên :
25/10/2012, 10:39
... clinically relevant and irrelevant findings, and simply reported on all abnormalities [12] At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands ... design and statistical analysis of the study MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript revision All authors read and approved the final ... journal on the utility of daily routine CXRs in clinical decision making in the ICU In that study, a questionnaire was completed for each radiograph, addressing the indication for the radiograph and...
- 7
- 722
- 0
Báo cáo y học: " High blood pressure, antihypertensive medication and lung function in a general adult population"
Ngày tải lên :
25/10/2012, 10:45
... medication within the last seven days before the examination was ascertained by an instrument for database-assisted online collection of medication data (IDOM) [19] The following substance classes ... Greifswald, Greifswald, Germany 7Central Hospital of Augsburg, MONICA/KORA Myocardial Infarction Registry, Augsburg, Germany 8Ludwig-Maximilians-University, Institute of Medical Data Management, ... Germany Authors’ contributions ES was responsible for the data analysis, interpretation of data and manuscript preparation JH and ES developed the statistical analysis plan SK, HS, SG, CM, MH, AP,...
- 8
- 579
- 1
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
Ngày tải lên :
25/10/2012, 10:45
... arrest) Gastrointestinal complications* Other Sepsis Cardiovascular Gastrointestinal Gastrointestinal bleeding Liver failure/cirrhosis review Acute COPD exacerbation Gastrointestinal commentary Respiratory ... defined as non-routine Changes in patient management were categorized as ETT placement or change in position, central line placement or change in position, thoracostomy tube placement or change ... determine the percentage of routine and non-routine radiographs that change management in our medical–surgical ICU, and to determine the specific resultant management changes Materials and methods...
- 5
- 506
- 0
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
Ngày tải lên :
25/10/2012, 10:45
... loudspeakers and paging system, and a detailed log of all calls is maintained Criteria for medical emergency team activation Calling criteria for our MET service are based on acute changes in heart ... drugs and defibrillators Outcome measures Information on the activation of all MET calls is maintained on a hospital switchboard logbook that includes the date and time of the call, as well as the ... period and related this to aspects of nursing and medical daily routine Materials and methods The hospital Austin Health is a university-affiliated teaching hospital with three hospital campuses...
- 4
- 541
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
Ngày tải lên :
25/10/2012, 11:00
... 16 Minamitani M, Tanaka J, Hasumura M, et al Cerebral malformations associated with probable intrauterine infection No To Hattatsu 1993; 25: 359-63 17 Singleton WG, Lawrence T, Green AL, et al ... that MZ with discordant handedness showed opposite brain activity patterns in language and a mental rotation task Sommer et al 14 have suggested that late splitting of the egg may play a role in ... head surgery17 In our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are...
- 4
- 652
- 0
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
Ngày tải lên :
25/10/2012, 11:18
... control, the imaging probe was placed either against the skin or at a distance from the skin in water for pre-treatment imaging The integrated transducer was mounted in a degassed water reservoir ... ear veins and ketamine was infused (50 mg/h) for anesthesia Diazepam was administered as needed The HIFU ablation procedure complies with the guidance of the National Standard of China and was described ... intervening tissues Anatomically the pancreas lies in deep abdomen and is surrounded by many important anatomic structures The gas-containing organs such as the gastrointestinal (GI) tracts are poor...
- 7
- 481
- 0