air lung interface as a predictor of observed health effects

Particle Toxicology - Chapter 11 pot

... from basophils (Devouassoux et al 2002) as well as mast cell (Diaz-Sanchez, Penichet-Garcia, and Saxon 2000) and eosinophil degranulation (Terada et al 1997) This release of granulocyte mediators ... organic extracts of DEP increase IL-8, GM-CSF and RANTES Alveolar macrophages Organic extracts of DEP and PM increase IL-8, TNF and COX2 Organic extracts of DEP increase IL-8 Organic extracts of ... Hirano, S., Furuyama, A. , and Kobayashi, T., cDNA microarray analysis of rat alveolar epithelial cells following exposure to organic extract of diesel exhaust particles, Toxicol Appl Pharmacol.,...

15
357
0

Báo cáo khoa học: Regulation of Cyr61/CCN1 gene expression through RhoA GTPase and p38MAPK signaling pathways Role of CREB and AP-1 transcription factors doc

Danh mục: Báo cáo khoa học

... phosphorylation state is determined by the level of activity of a myriad of signaling cascades that leads to the activation of CREB kinases such as PKA, RSK, calmodulin kinase and MSK1/2 It was suggested ... indicated time periods and the amount of GTP-loaded RhoA (active form of RhoA) was determined by pull-down assay as described in Materials and methods Total amount of RhoA in the same samples was ... interact with the basal transcriptional machinery and increase the rate of transcription Perhaps, activation of CREB in S1P-treated cells leads to recruitment of coactivators such as CBP/P300 that...

14
415
0

Withdrawing from Iraq- Alternative Schedules, Associated Risks, and Mitigating Strategies potx

Danh mục: Khoa học xã hội

... efforts greatly improved the report Abbreviations AAB advise and assist brigade AMC U.S Army Materiel Command AQ al-Qaeda AQI al-Qaeda in Iraq ARCENT U.S Army Central Command ARI automatic return ... Al-Rubaie, National Security Advisor Ambassador Samir Shakir Al-Sumaydi, Iraqi Ambassador to the United States General Nasier A Abadi, Joint HQ VCOS LTG Hussein al-Awadi, Commander, National Police ... political process as essential, and participation in government as important As a result, all major factions—Sunni, mainstream Shi a parties (i.e., alDa’wa and the Islamic Supreme Council of Iraq...

208
271
0

Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx

Danh mục: Báo cáo khoa học

... 5¢-AACAGTCTCTACAATGCGGCCA-3¢ and antisense, 5¢-CCGTGTTCCATTACAAGCAGAA-3¢); SAE1 (sense, 5¢-GACCTGCTTCCCGATGACTTT-3¢ and antisense, 5¢-TTCCTCCAACCACAGCACATAC-3¢); UBC9 (sense, 5¢-CAACAAAGAACCCTGATGGCACGA-3¢ ... 5¢-CAACAAAGAACCCTGATGGCACGA-3¢ and antisense, 5¢-GCATCCGTAGCTTGAACAAGCCTC-3¢); PIAS3 (sense, 5¢-ACTGCAGGGACCCTGCTACA-3¢ and antisense, 5¢-CTTGATCAGTGCTCGGGAATG-3¢); PIASxa (sense, 5¢-TGCACCTCATTCACCGTCAT-3¢ and antisense, ... (Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan) The plasmid pFLAG-PIAS3, which encodes FLAG-tagged mouse PIAS3, was a gift from K Shuai (University of California, Los Angeles, CA, USA)...

12
443
0

Erectile Dysfunction – Disease-Associated Mechanisms and Novel Insights into Therapy Edited by Kenia Pedrosa Nunes potx

Danh mục: Sức khỏe giới tính

... for cardiovascular risk prevention Nat Clin Pract Cardiovasc Med 2007;4: 263-73 [108] Yassin AA, Akhras F, El-Sakka AI, Saad F Cardiovascular diseases and erectile dysfunction: the two faces of ... decreased eNOS activity and impaired vascular function Moreover, inhibition of arginase via an adeno-associated virus (AVV) gene transfer of anti-arginase in this tissue increases penile eNOS activity ... inhibition of p38 MAPK attenuates organ damage and improves vascular function in cardiovascular diseases 104-105 Recently, it was demonstrated that p38 MAPK increases arginase activity and contributes...

226
467
0

Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Danh mục: Báo cáo khoa học

... markers associated with airways hyperreactivity in asthmatics and platelet activating factor acetylhydrolase [29] Ober et al [30] recently reported strong linkage of 19q markers with asthma and ... 11783–11786 Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... evidence that inﬂammatory cell inﬁltrates play a signiﬁcant role in driving the pathogenesis of asthma and other allergic diseases by damaging tissue and releasing pro-inﬂammatory agents Activated...

14
540
0

báo cáo hóa học:" Bioactivity-guided identification and cell signaling technology to delineate the immunomodulatory effects of Panax ginseng on human promonocytic U937 cells" potx

Danh mục: Hóa học - Dầu khí

... LKS Faculty of Medicine, Purapharm International, and Prof SK Lau and Mr William Au Research Fund awarded to Prof Allan Lau The Panax ginseng extract was provided by Prof Wang Jianxin, Shanghai ... 58:1685-1693 Ho LJ, Juan TY, Chao P, Wu WL, Chang DM, Chang SY, Lai JH: Plant alkaloid tetrandrine downregulates IkappaBalpha kinasesIkappaBalpha-NF-kappaB signaling pathway in human peripheral blood T ... Journal of Translational Medicine 2009, 7:34 Background Panax ginseng (ginseng) has been used as a herbal remedy in ancient China and Asian countries for thousands of years and became popular in...

10
500
0

báo cáo hóa học: " Treatment with gelsolin reduces brain inflammation and apoptotic signaling in mice following thermal injury" potx

Danh mục: Toán học

... Assessment of cysteinyl aspartate-specific protease (caspase)-3 activity Caspase-3 activity was measured using a colorimetric assay according to the manufacturer’s instructions (BioVision, Mountain ... inhibit caspase-3 activation in our model, we measured levels of caspase-3 activity in the brain tissue We found that there was an approximately 2-fold increase in caspase-3 activity in the placebo ... survival rates among the groups were analyzed by the KaplanMeier method using an SPSS software package Page of 18 Each sample was tested in triplicate The relative concentration of mRNA was calculated...

18
276
0

Báo cáo hóa học: " Resveratrol engages AMPK to attenuate ERK and mTOR signaling in sensory neurons and inhibits incision-induced acute and chronic pain" pptx

Danh mục: Hóa học - Dầu khí

... tillud@email.arizona.edu Ohannes K Melemedjian,Aff1† Email: ohannes@email.arizona.edu Marina N Asiedu,Aff1 Email: masiedu@email.arizona.edu Ning Qu,Aff1 Email: ningq@email.arizona.edu Milena De Felice,Aff1 ... processes such as protein translation [19] AMPK activation achieves these effects largely through inhibition of mammalian target of rapamycin (mTOR) signaling [19] but AMPK activation has also been ... pharmacological mechanisms for activation of AMPK may have utility as novel analgesics for a variety of pain conditions Anabolic processes, such as protein synthesis, are orchestrated by upstream kinases...

27
301
0

Associated Technologies And Milling Cutter by J Smith_2 doc

Danh mục: Điện - Điện tử

... reducing the potential risk of its damage via vibrational effects Therefore, if the insert inclination is such that the approach angle is almost flat, this has the advantage of the axial force component ... ‘lay’ Alternatively, a reasonable estimate of the milled concavity ‘f’ can be obtained from the graph in Fig 86 (bottom), that illustrates the variation in the concave shape, for a variety of spindle ... particularly prevalent on brittle-types of workpiece materials, such as: (most) Brasses, (many) Cast irons, (some) Powder Metallurgy compacts, together with (many) non-metallic materials – Plastics,...

10
317
0

Associated Technologies And Milling Cutter by J Smith_4 pptx

Danh mục: Điện - Điện tử

... 180 Chapter Modern Metal Cutting – A Practical Handbook AB Sandvik Coromant Pub., 1994 Oxley, P.L.B Mechanics of Machining Ellis Horwood Pub., 1989 Shaw, M.C Metal Cutting Principles ... 1989 Society of Manufacturing Eng’rs., Tool and Manufacturing Engineers Handbook – Vol – Machining 4th Ed., SME Pub., Dearborn, Mich., 1983 Smith, G.T Advanced Machining – The Handbook of Cutting ... IFS/Springer Verlag, 1989 Smith, G.T CNC Machining Technology Springer Verlag, 1993 Tlusty, G Manufacturing Processes and Equipment Prentice Hall, 2000 Usui, E Modern Machining Theory [i.e In Japanese]...

2
346
0

Molecular and Cellular Signaling docx

Danh mục: Cao đẳng - Đại học

... readily deduced 5-HT 5-hydroxytryptamine (serotonin) AA AC ACE ACF ACh ACTH ADAM ADHD ADP AFM AGC AHL AIDS AIF AIP AKAP ALK ALS arachidonic acid adenylyl cyclase angiotensin-converting enzyme ATP-dependent ... as signals, as receptors of the signals, as transcription factors that turn genes on and off, and as signaling transducers and intermediaries The signaling and regulatory proteins and associated ... ADP-ribosylation factor alternative reading frame (of exon 2) Arabidopsis response regulator ataxia-telangeictasia mutated adenosine triphosphate ATM and Rad3-related atrioventricular node vasopressin...

592
215
0

ERECTILE DYSFUNCTION – DISEASE-ASSOCIATED MECHANISMS AND NOVEL INSIGHTS INTO THERAPY pdf

Danh mục: Sức khỏe giới tính

... for cardiovascular risk prevention Nat Clin Pract Cardiovasc Med 2007;4: 263-73 [108] Yassin AA, Akhras F, El-Sakka AI, Saad F Cardiovascular diseases and erectile dysfunction: the two faces of ... decreased eNOS activity and impaired vascular function Moreover, inhibition of arginase via an adeno-associated virus (AVV) gene transfer of anti-arginase in this tissue increases penile eNOS activity ... inhibition of p38 MAPK attenuates organ damage and improves vascular function in cardiovascular diseases 104-105 Recently, it was demonstrated that p38 MAPK increases arginase activity and contributes...

226
256
0

Báo cáo sinh học: "The Drosophila Forkhead transcription factor FOXO mediates the reduction in cell number associated with reduced insulin signaling" potx

Danh mục: Báo cáo khoa học

... resultant UAS constructs are referred to as UAS-dFOXO, UAS-dFOXO-TM, UAS-hFOXO 3a and UAS-hFOXO 3a- TM To generate transgenic Drosophila lines, P-element-mediated germline transformation was carried ... supported J.D.W in part References Takahashi Y, Kadowaki H, Momomura K, Fukushima Y, Orban T, Okai T, Taketani Y, Akanuma Y, Yazaki Y, Kadowaki T: A homozygous kinase-defective mutation in the insulin ... Journal of Biology 2003, 51 Yanase S, Yasuda K, Ishii N: Adaptive responses to oxidative damage in three mutants of Caenorhabditis elegans (age-1, mev-1 and daf-16) that affect life span Mech Ageing...

17
318
0

Báo cáo sinh học: "Dishevelled and Wnt signaling: is the nucleus the final frontier" potx

Danh mục: Báo cáo khoa học

... and how signals are channeled to each pathway Notably, some Wnt ligands are known to activate both canonical and non-canonical pathways such as Wnt 3a, whereas others such as Wnt 5a appear to be specific ... Daam1 that binds to the PDZ domain of Dsh, leads to the activation of the Rho-associated kinase ROCK, and mediates cytoskeletal re-organization [8,13,14] Rac activation is independent of Daam1, ... 2.2 Journal of Biology 2005, Volume 4, Article Habas and Dawid (a) Canonical pathway http://jbiol.com/content/4/1/2 (b) Non-canonical or planar (c) Wnt-Ca2+ pathway cell polarity pathway Wnt Wnt...

4
286
0

Báo cáo y học: " Eph Receptors and Ephrin Signaling" pps

Danh mục: Báo cáo khoa học

... regulate the activity of the Ras family of GTPases, including H-Ras and R-Ras [13, 14] Activation of H-Ras leads to activation of the MAP kinase pathway, resulting in transcriptional regulation, ... small GTPases of the Rho and Ras family, focal adhesion kinase (FAK), the Jak/Stat pathway and the PI3K pathway [7] [8] Small GTPases of the Rho family mediate the effect of Eph receptor activation ... bone remodeling Breast cancer bone metastases are associated with the development of an osteolytic bone disease, and a recent study has implicated EphA2 as a potential mediator of this bone destruction...

10
306
0

Báo cáo y học: "Activation of WNT and BMP signaling in adult human articular cartilage following mechanical injury" potx

Danh mục: Báo cáo khoa học

... forward 5'-CAACCGTGAGGAAAATCGATGCAG-3', reverse 5'-CGGCAAGATACAGATTCACGCTCAA-3', 440 bp; MMP13 (GeneBank:NM_002427), forward 5'-ACGGACCCATACAGTTTGAATACAGC-3', reverse 5'-CCATTTGTGGTGTGGGAAGTATCATC-3, ... (GeneBank:NM_001200), forward 5'-CGTCAAGCCAAACACAAACAGCG-3', reverse 5'- CACCCACAACCCTCCACAACCAT-3', 341 bp; FRZB (GeneBank:U24163), forward 5'GGGCTATGAAGATGAGGAACGT-3', reverse 5'-ACCGAGTCGATCCTTCCACTT-3', ... signaling is required for postnatal maintenance of articular cartilage PLoS Biol 2004, 2:e355 37 Tsumaki N, Tanaka K, Arikawa-Hirasawa E, Nakase T, Kimura T, Thomas JT, Ochi T, Luyten FP, Yamada...

13
418
0

Báo cáo y học: "Activation of proteinase-activated receptor 2 in human osteoarthritic cartilage upregulates catabolic and proinflammatory pathways capable of inducing cartilage degradation: a basic science study" pot

Danh mục: Báo cáo khoa học

... 5'-GAAGCCTTATTGGTAAGGTTG (sense) and 5'-CAGAGAGGAGGTCAGCCAAG (anti-sense) for PAR-2 and 5'CAGAACATCATCCCTGCCTCT (sense) and 5'-GCTTGACAAAGTGGTCGTTGAG (anti-sense) for GAPDH In brief, 10 μL of ... a possible therapeutic value for PAR-2 antagonists in the treatment of OA, not only as an anticatabolic and anti-inflammatory but as an analgesic as well Indeed, the proanalgesic properties of ... manuscript preparation NA participated in acquisition of data, analysis and interpretation of data, statistical analysis, and manuscript preparation JMP and JPP participated in study design, analysis...

10
361
0

Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

Danh mục: Báo cáo khoa học

... [GenBank:NM_004064] 5'AGATGTCAAACGTGCGA GTG-3' (sense) 5'TCTCTGCAGTGCTTCTC CAA-3' (antisense) 59 40 154 RAGE [GenBank:AB036432] 5'GGAAAGGAGACCAAGT CCAA-3' (sense) 5'CATCCAAGTGCCAGCTA AGA-3' (antisense) ... 166 RANKL [GenBank:AF019047] 5'GCTTGAAGCTCAGCCTT TTG-3' (sense) 5'CGAAAGCAAATGTTGGC ATA-3' (antisense) 59 40 192 TNF-α [GenBank:NM_000594] 5'GGCAGTCAGATCATCTT CTCGAA-3' (sense) 5'AAGAGGACCTGGGAGT ... synthesis For evaluation of cell viability and metabolic activity the MTT assay was used The assay is based on the cleavage of tetrazolium salt (MTT) to coloured formazan by metabolic active cells,...

19
395
0

báo cáo khoa học: "Different patterns of NF-B and Notch1 signaling contribute to tumor-induced lymphangiogenesis of esophageal squamous cell carcinoma" ppt

Danh mục: Báo cáo khoa học

... with Kaposi’s sarcoma and a subset of angiosarcomas Mod Pathol 2002, 15:434-440 20 Tanaka T, Ishiguro H, Kuwabara Y, Kimura M, Mitsui A, Katada T, Shiozaki M, Naganawa Y, Fujii Y, Takeyama H: Vascular ... intensity level was presented as a ratio of the percentage of surface area covered at each intensity score to total tumor cell area Areas that were negative were given a value of We analyzed 10-12 ... 2(4):301-310 27 Shishodia S, Aggarwal BB: Nuclear factor-kappaB activation mediates cellular transformation, proliferation, invasion angiogenesis and metastasis of cancer Cancer Treat Res 2004, 119:139-173...

9
287
0