... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
Ngày tải lên: 17/04/2013, 16:09
... Annals of Mathematics, 164 (2006), 1033–1064 Analytic representation of functions and a new quasi-analyticity threshold By Gady Kozma and Alexander Olevski˘ ı* Abstract We characterize ... boundary value of a Nevanlinna class function That example is L∞ and can be made continuous, but it cannot be made smooth in any reasonable sense without leaving the Nevanlinna class 2.4 The harmonic ... singular points of the boundary was investigated for F from the Nevanlinna class; see Shapiro [S66], Shamoyan [S95] and Bourhim, El-Fallah and Kellay [BEK04] In particular, applying theorem A of...
Ngày tải lên: 29/03/2014, 07:20
RBF Neurals Networks and a new algorithm for training RBF networks
... D.S Bromhead and D Lowe, “Multivariable functional interpolation and adaptive networks”, Complex Systems, vol 2, 1988, pp 321-355 J.Park and I.W Sandberg “Approximation and radial-basis-function ... California from the 1990 Cens us In this sample a block group on average includes 1425.5 individuals living in a geographically compact area Naturally, the geographical area included varies inversely ... Intelligent Learning Systems and Applications, Vol.3 No.1, February 2011, pp 17-25 20 Tomohiro Ando, Sadanori Konishi and Seiya Imoto, Nonlinear regression modeling via regularized radial basis function...
Ngày tải lên: 12/04/2014, 15:40
Báo cáo hóa học: " Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease" pot
... Piracicaba – SP Piracicaba – SP Piracicaba – SP Piracicaba – SP Brasília – DF Brasília – DF Acreuna – GO Presidente Olegário -MG Holambra – SP Primavera Leste – MT Primavera Leste – MT Primavera Leste ... design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements We thank Dr Carlos Eduardo Guerra Schrago and Dr Marcelo Soares from ... Location1 Cotton sp Cultivar Isolate Date Symptom2 Nested PCR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Sta Helena de Goiás – GO Piracicaba – SP Piracicaba – SP Piracicaba...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx
... Misiak [3], a Kim and Cho [4], and Malˇeski [5] developed the theory of n-normed c space In [6], Gunawan and Mashadi gave a simple way to derive an (n−1)-norm from the n-norms and realized that any ... An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur–Ulam problem Choonkil Park1 and Cihangir Alaca∗2 Department of Mathematics, Research Institute for Natural ... Bag and Samanta [8] and also gave some fundamental properties of this space In 1932, Mazur and Ulam [11] proved the following theorem Mazur–Ulam Theorem Every isometry of a real normed linear...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " Research Article ML-PDA: Advances and a New Multitarget Approach" potx
... residual data set the ML-PDA algorithm is applied and the resulting track estimate validated If a new target is validated, its associated measurements are also edited out to form a new residual data ... incorporates all phases of the tracking problem: track initiation, track maintenance/update, and track termination functions and uses the ML-PDA and JMLPDA algorithms for track update Figure shows a ... frames of data, track estimates separated by fewer than Nw frames are correlated in that they use common data frame(s) EURASIP Journal on Advances in Signal Processing Table 3: Scenario parameters...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo y học: "Ventilator-associated tracheobronchitis (VAT): questions, answers, and a new paradigm" ppt
... Thoracic Society and Infectious Diseases Society of America (ATS/IDSA): Guideline for the Management of Adults with Hospital-acquired, Ventilator-associated, and Healthcareassociated Pneumonia Am ... independent data analysis and data safety monitoring boards, that would greatly increase our understanding of disease pathogenesis, prevention, and treatment Such a network could provide a foundation ... 0.001), and a lower ICU mortality (P < 0.05) These data of Nseir and coworkers [1] are interesting and provocative and suggest that VAT caused by these pathogens may be a marker for patients at high...
Ngày tải lên: 13/08/2014, 11:22
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC ... 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA 16 TTTGCGGCCGCATGGATGATGATATCGCCGCG 17 TTTCTCGAGCTAGAAGCATTTGCGGTGGAC ... TTTCTCGAGCTAGAAGCATTTGCGGTGGAC 18 CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG...
Ngày tải lên: 13/11/2014, 10:46
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model
... Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied when necessary for comparisons A value ... regulates many essential functions such as maintaining background vasodilatation in small arteries and arterioles, regulation of microvascular and epithelial permeability NO’s role as a neurotransmitter ... area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area for each group of rats The data of 6th day suggests the largest...
Ngày tải lên: 26/09/2015, 09:39
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene
... ethanol15 to give alkene 10 Careful acetylation of 10 with acetic anhydride and DMAP in dichloromethane gave the acetate 11 contaminated with (presumably) its cis-azulene epimer (10% by H NMR) All ... comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone and treated with a catalytic amount of p-toluenesulfonic acid Compound was obtained (crystalline ... tert-butyl acetate22 (generated from tert-butyl acetate and LDA in THF at À78 °C) to 21 afforded an adduct that was desilylated without purification The mixture of diols 22 so obtained was oxidized...
Ngày tải lên: 26/01/2016, 09:27
Vietnamese chitin raw material, the chitin de n acetylation reaction, and a new chitosan alginate gelling concept
... Draget for his guidance and critical discussions on chitosan-alginate gels, Finn L Aachmann for his expertise with NMR, Olav A Aarstad for preparing alginate oligomers, and Wenche I Strand, Ann-Sissel ... measurement (Anthonsen et al., 1993; Park et al., 1983; Strand et al., 2001) The literature data on the relationship between pKa and DA are somewhat inconsistent Anthonsen et al (1993) and Strand ... neurotoxic (Beauchamp et al., 1992) and glyoxal is mutagenic (MurataKamiya et al., 1997) Genipin is a naturally occurring material that offers an interesting alternative to dialdehydes and is not...
Ngày tải lên: 18/07/2016, 20:13
Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt
... sequences were as follows: 5'-GCTGTTTTTATGCTAACAAGTCC and 5'-GATAAAGGTCATCAGC CT ATTGA for Env-Ory1 and 5'-CCTCTAAATGTCATCTTCACCAG and 5'-CTATTGGGACAGCAGTTCTAGTC for EnvOry2, The transcript levels ... Ensembl databases Conclusion Here we have shown that within a placental mammal that has developed a haemochorial placenta with a syncytiotrophoblast layer at the maternal-fetal interface, such as the ... of a rabbit placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the main layers of the placenta indicated (B) Higher magnification of the areas framed...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... involved in critically revising the draft JG made substantial contributions to the data analysis GB was substantially involved in the analysis, interpretation and drafting the manuscript Acknowledgements ... care unit JAMA 1999, 282:267-270 British Medical Association and the Royal Pharmaceutical Society of Great Britain: British National Formulary March edition London; 2003 National Coordinating Council ... death had they been administered as prescribed This CPOE system lacks the ability to effectively deal with drugs with variable dosage regimens such as vancomycin, gentamicin and warfarin In addition,...
Ngày tải lên: 25/10/2012, 10:39
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... kinetics and bioavailability Intravenous, oral and rectal administration Cancer Chemother Pharmacol 1982;8:93-98 Jaeger H, Russmann D, Rasper J, Blome J Comparative study of the bioavailability and ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...
Ngày tải lên: 31/10/2012, 14:59
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... as we have seen it also has syntactic implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...
Ngày tải lên: 10/04/2013, 14:46
CHAPTER ELEVEN MIND MAPPING a NEW DIMENSION IN THINKING AND NOTE TAKING
... recall of each story you use a card filing system For each story you have one card for the title and author, and a card for every paragraph On each of these paragraph cards you enter a main and ... main and secondary idea for the first five paragraphs only, in the space provided on page 76 72 NOTING Kusa-Hibari Lafcadio Hearne His cage is exactly two Japanese inches high and one inch and ... the list and forgotten while a new idea is searched for This means that all the multi-ordinate and associative possibilities of each word are cut off and boxed away while the mind wanders around...
Ngày tải lên: 09/08/2013, 11:51
Tài liệu tiếng anh Điện tử công suất mạch MERS A new AC current switch called MERS with low on state voltage IGBTs for renewable energy and power saving applications
... terminals will not lead to a short of the transistors Additionally, the capacitor is smaller than a normal voltage source converter Based on these characteristics, a new low on-state voltage IGBT ... losses are comparatively high The relative losses for a real scale system have been estimated and also included in the figure By increasing the dc-link voltage, and as a result the no-load voltage ... connection of IGBTs (a) Time-trends of voltage sharing of three IGBTs for the case of 1000 Hz and 100 A (b)Configuration [2] K Shimada, T Takaku, T Matsukawa, and R Shimada, “Bi-directional current switch...
Ngày tải lên: 15/10/2013, 16:10
Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.
... is also very powerful, faster than ASP, and instantly familiar to Java programmers It allows the Java program to leverage the aspects of the Java2 platform such as JavaBeans and the Java libraries ... support via something known as the Java Virtual Machine (JVM), and there are several standard and non-standard tags that are used to add Java applets to a web page These tags tell ... than Java, and also you don't have to worry about integrating different languages into the page, as Curl is capable of providing the same features as both Java and JavaScript 16 Getting Started...
Ngày tải lên: 06/11/2013, 00:15
Tài liệu Create a Dialog Box to Connect to a New Database, Including Listing Available SQL Servers and Databases pdf
... As Integer Dim oNames As SQLDMO.NameList Dim oSQLApp As New SQLDMO.Application() ' Load available SQL Servers into a NameList ' (those that are able to be seen by the network) oNames = oSQLApp.ListAvailableSQLServers ... same module as step 2, create the routine called LoadSQLServers After establishing an instance of the SQL-DMO application, the code calls the ListAvailableSQLServer method If no names are loaded ... string Called BuildCnnStr, the function can be seen in Listing 7.1 This function takes a server and database names passed to it and returns a connection string You will want to create a basic module...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx
... rural Ontario (McKay et al., 1998) and 95% in rural Nova Scotia (Langille et al., 1996), and suggests that the fears teachers and administrators have of parental and community opposition may ... homosexuality and relationships have no place in an academic institution Issues such as avoiding sexual abuse and awareness of The Canadian Journal of Human Sexuality, Vol 11 (1) Spring 2002 Table ... that may be considered controversial, such as masturbation, homosexuality, and sexual pleasure and orgasm It appears that parents recognize and support their children’s need for information about...
Ngày tải lên: 14/02/2014, 14:20