afebrile with no genital lesions and has a negative urinalysis for pyuria what are the mos
Báo cáo y học: "The STRS (shortness of breath, tremulousness, racing heart, and sweating): A brief checklist for acute distress with panic-like autonomic indicators; development and factor structure" ppt
Ngày tải lên :
08/08/2014, 20:23
... research has examined the diagnostic and prognostic value of any sign except for tachycardia The lack of a validated measure that utilizes multiple discrete indicators of acute autonomic activation ... Health Care System, Spark M Matsunaga Medical Center Support was also provided by a National Alliance for Research on Schizophrenia and Depression (NARSAD) Independent Investigator Award, and the ... interpretable factor structure of the STRS confirms the adequacy of the two theoretical latent variables: 1) PTSD diagnostic criterion A, and 2) peritraumatic acute autonomic activation Several sample...
- 8
- 491
- 0
Báo cáo y học: "PTPN22 polymorphism and anti-cyclic citrullinated peptide antibodies in combination strongly predicts future onset of rheumatoid arthritis and has a specificity of 100% for the disease" ppsx
Ngày tải lên :
09/08/2014, 07:20
... forward primer was 5'-CAACTGCTCCAAGGATAGATGATGA-3 'and the reverse primer was5'-CCAGCTTCCTCAACCACAATAAATG-3' The probes were labelled at their 5' ends with FAM™ (the C allele) and VIC™ (the T allele) ... allele) and the 3' ends contained quenchers and minor groove binders The probe for the A allele was 5'-6FAMTCAGGTGTCCGTACAGG-MGB-Q-3' and for the G allele 5'-VIC-TCAGGTGTCCATACAGG-MGB-Q-3' Primers and ... of the genes and antibodies were then evaluated Materials and methods A nested case-control study was performed within the Medical Biobank of Northern Sweden of the Northern Sweden Health and...
- 6
- 322
- 0
báo cáo khoa học: "A solid pseudopapillary tumor of the pancreas treated with laparoscopic distal pancreatectomy and splenectomy: a case report and review of the literature" ppt
Ngày tải lên :
11/08/2014, 02:22
... journal 17 18 19 Authors’ contributions GA analyzed and interpreted the data from the patient’s medical file; GA and AM drafted the manuscript; GA, AM, and GP critically revised the manuscript and ... to laparoscopic distal pancreatectomy are benign lesions (for example, large serous cystadenomas), chronic pancreatitis, lesions that carry potential for malignant transformation (particularly ... pancreatectomy, a fact that may limit the applicability of laparoscopic surgery to the treatment of pancreatic adenocarcinoma The issue of spleen preservation is somewhat controversial in the literature and...
- 4
- 236
- 0
Báo cáo y học: " Kaposi''''s sarcoma of the hand mimicking squamous cell carcinoma in a woman with no evidence of HIV infection: a case report" pptx
Ngày tải lên :
11/08/2014, 21:22
... sarcoma carcinoma A primaryas a squamous cell on a hand, which was first A primary Kaposi's sarcoma on a hand, which was first regarded as a squamous cell carcinoma Wide local excision with histologically ... spaces and sarcoma consisting of angiomatoid 40 A) Kaposi'sabundant spindle-shaped cells HE × vascular A) Kaposi's sarcoma consisting of angiomatoid vascular spaces and abundant spindle-shaped ... of the patient's origin, were misleading The best treatment modality is still a matter of debate and no standard treatment guidelines are available Many patients have cutaneous lesions amendable...
- 5
- 256
- 0
Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt
Ngày tải lên :
12/08/2014, 04:20
... conducted the data analysis and drafted the manuscript FG and HK participated in the data analysis and review of the manuscript YN performed project planning, participated in the data analysis and helped ... proteins of the coated vesicle adaptor protein complex (AP): γ-adaptin, a marker for AP-1 [41]; δ-adaptin, a marker for AP-3 [42] Both AP-1 and AP-3 localizes to TGN and endosomes, with AP-3 localizes ... colocalization of UL56 was also seen with γ-adaptin, δ-adaptin, and EEA1, whereas UL56 showed little or no colocalization with markers for late endosomes UL56 and rab7 did not colocalize either at h or h postinfection...
- 13
- 290
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
Ngày tải lên :
18/02/2014, 02:20
... education are weak (they generally are not temporally close and not show explicit payback), and the exchanges in law may be temporally close and explicit but generally are based on coercion and are ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... behave as they Primary and selective demand Commercial managers generally seek changes in selective demand after the primary demand decision with respect to the product class already has been made...
- 14
- 780
- 0
UP AND AWAY: A resource book for English language support in primary schools pptx
Ngày tải lên :
19/03/2014, 08:20
... learnt and familiar words and phrases Native speakers who are aware of what the pupil has been learning and familiar with the pronunciation patterns of pupils from different language backgrounds can ... vocabulary have been studied in advance and there is appropriate visual support • Can understand the main points of stories that are read aloud in the mainstream classroom • Can understand a large ... Section The curriculum for language support (continued) A1 BREAKTHROUGH A2 WAYSTAGE • Can greet, say ‘Please’ and ‘Thank you’, and ask for directions to another place in the school • Can ask for attention...
- 248
- 776
- 0
Determinants of General Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany doc
Ngày tải lên :
22/03/2014, 13:20
... complex therapy and care as well as increased needs for social, medical and health care (Akker et al 1998) We analysed multimorbidity as cumulative occurrence of heart diseases, cerebral vascular ... self-determination, social and cultural activity and social status (Mollenkopf & Walker 2007) Additionally, the economic status can also decrease by the supplemental costs for illness and care The continuity ... arrangement and social networks are behaviours and lifestyle factors which are known to be related to health However, the causal associations are complex and interrelated to an individual’s socioeconomic...
- 61
- 545
- 0
INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt
Ngày tải lên :
31/03/2014, 15:20
... SURVEY What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for Quotes throughout are from professional animators ... EDUCATION We asked professional animators about the type of education they got and what they thought was most important to getting started in their animation career Although professional animators ... potential students about their education by country, Australia, Canada, Germany, the U.S and the UK chose quality of curriculum as their top picks Canada also highly valued individual attention, as...
- 14
- 465
- 0
domain names, how to choose and protect a great name for your website (2000)
Ngày tải lên :
18/04/2014, 14:04
... domain name will appear in the PTO's trademark database as a pending trademark Anyone doing a trademark search (see Chapter 6) will find your name and know that you are claiming it as a trademark ... is generally the best place to start your research Federal trademark laws are collectively known both as the Lanham Act and as the Federal Trademark Act of 1946 (as amended) The Lanham Act is ... Bearware mark over the Internet, but she uses the domain name bareware.com Peter can sue Gail for trademark infringement, asking the court to stop Gail from using the Bearware mark and the barewear.com...
- 68
- 418
- 0
the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities
Ngày tải lên :
31/05/2014, 01:37
... on safety should be made Are exits readily accessible? Is the safety shower easy to reach? Are areas for handling hazardous materials properly segregated? Are areas of potential hazards away from ... hiking As a rule, analytical balances are placed on separate tables, which should be large enough to also hold a desiccator for samples and the operator's notebook The table must be as stable as the ... ventilation may be required ANALYTICAL BALANCES Analytical balances are among the prima donnas of the laboratory, requiring separate and unequal treatment They refuse to cooperate if there is the...
- 173
- 561
- 0
Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?
Ngày tải lên :
02/06/2014, 15:10
... pay high costs for Media Companies because their products advertised many times a day and many different channels In addition to payment for famous stars LEAFLET STRENGTHS Advertising leaflets ... of advertisement by the leaflets because the fee is fairly cheap compared with other types LEAFLET WEAKNESSES Advertising leaflets can not create the trust for customers The customers usually ... products and services and their utilities, cost and other requirements It helps consumers know what is the best option for them INFORMATIVE ENTERTAINING Advertising is interesting It attracts not...
- 20
- 862
- 0
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx
Ngày tải lên :
18/06/2014, 19:20
... collaborate with the industry as their research programs mature QSTP facilitates the engagement of the private sector with the universities, as a base for multi-national and national companies ... make Qatar a leader in innovative education and research.” Under the leadership of His Highness Sheikh Hamad Bin Khalifa Al-Thani, the Emir of Qatar and founder of Qatar Foundation, and Her Highness ... basic and applied research In accordance with its mission, the Qatar Foundation has embarked on an innovative and visionary set of initiatives to create lasting benefits for the country of Qatar...
- 8
- 375
- 0
báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx
Ngày tải lên :
19/06/2014, 22:20
... thank the Oklahoma Medical Research Imaging Core Facility for their assistance and Mrs Marilyn Bonham-Leyba for assistance with manuscript preparation References 10 Pramatarova A, Laganiere J, Roussel ... in large part by the ALS Association; the Oklahoma Center for the Advancement of Science and Technology (HR02149RS); and the National Institutes of Health (AG20783, NS044154) We thank the Oklahoma ... obtained from paired neonatal pups (littermates in the case of G9 3A- SOD1 +/- and -/- mice) Paired cultures were prepared on the same day and subject to medium changes and manipulations in exactly...
- 9
- 436
- 0
báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc
Ngày tải lên :
20/06/2014, 03:20
... collaborate with the industry as their research programs mature QSTP facilitates the engagement of the private sector with the universities, as a base for multi-national and national companies ... make Qatar a leader in innovative education and research.” Under the leadership of His Highness Sheikh Hamad Bin Khalifa Al-Thani, the Emir of Qatar and founder of Qatar Foundation, and Her Highness ... basic and applied research In accordance with its mission, the Qatar Foundation has embarked on an innovative and visionary set of initiatives to create lasting benefits for the country of Qatar...
- 8
- 494
- 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
Ngày tải lên :
20/06/2014, 08:20
... Several individual projects assessing the feasibility of various collaborative and integrative efforts at the healthcare delivery level in urban and rural areas have been carried out or are ongoing ... programs are characterized by firmly established algorithms, standardized measures and outcomes, and are designed to treat large numbers of patients with few resources On the other hand, HIV care and ... proposed alternative paradigm The current common paradigm is characterized by separate and distinct programs with little coordination or overlap The alternate paradigm emphasizes the need for increased...
- 5
- 469
- 0
Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf
Ngày tải lên :
09/08/2014, 10:22
... of thermal imaging of the wrist and MCP, normal adult wrists and hands from controls were imaged on separate days Three thermal scans were obtained at each session and the HDI was calculated for ... manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Taschawee Arkachaisri, Daniel Kietz, Paul Rosen, and Mary Chester Wasko for their assistance with recruitment ... B, Akoka S, Avimadje AM, Garaud P, Naccache L, Le Pape A, Valat JP: Magnetic resonance imaging: a valuable method for the detection of synovial inflammation in rheumatoid arthritis J Rheumatol...
- 9
- 344
- 0
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
Ngày tải lên :
09/08/2014, 10:23
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' ... DREAM 5'-CCGGCTAAGGAAGTGACAAA-3' 5'-CAAAGGCGTTGAAGAGGAAG-3' nDREAM 5'-GAAGGAGGGTATCAAGTG-3' 5'-TAAATGAGTTTGAAGGTGTC-3' Primers for SYBR green assay real-time PCR Forward c-fos Reverse 5'-TAAATGAGTTTGAAGGTGTC-3'...
- 8
- 576
- 0
Báo cáo sinh học: " A simple, practical and complete O -time Algorithm for RNA folding using the FourRussians Speedup" docx
Ngày tải lên :
12/08/2014, 17:20
... order to make this point, we keep all conditions for the comparisons the same, we emphasize the ratio of the running times rather than the absolute times, and we not incorporate any additional heuristic ... every binary vector v and then computing and storing the value k*(i, g, v) The variable i ranges from to n and there are 2q-1 binary vectors Hence the table section for any complete group g takes ... complete, in other words i is greater than k (where k ∈ Rgroup g), the maximum fold cannot be found in parallel The asymptotic time for the if branch remains the same as in the non-parallel algorithm:...
- 8
- 333
- 0