... telephone call openings appear at first sight to be a relatively simple and invariable routine, there is actually great variation in the way they are realized across languages, institutions and individuals ... tradition in pragmatics, because its data remain open to any investigator inspection Any reader may test the claims by inspecting the transcriptions and recordings used as exemplars (Hopper, ... systematic investigation in this area dates back to Schegloff s (1968) analysis of telephone calls openings in the United States This and much of subsequent research was carried out within the Conversation...
... differences in the ways particular activities are carried out and signaled Using Conversation Analysis (CA) as the methodology, this study illustrates the cultural characteristics of the format and interactional ... patterns in the data and the recognition of the most evident cross-cultural differences Ina subsequent phase, systematic comparison across languages was carried out by a quantitative analysis ... conversations and also taught the conversational structures and options as well as formulaic expressions Telephone call openings represent an ideal object of study for cross-cultural pragmatics research...
... Emergency Response and Intervention Trial ANZICS-APD, Australian and New Zealand Intensive Care Society Adult Patient Database tals, and tertiary hospitals In these hospitals, data were obtained for ... introduced an MET service using the first year of data as baseline and the second year as comparator Finally, an additional and similar analysis was performed for hospitals that had participated in the ... (c) to assess the association between MET service introduction and the incidence and rate of ICU readmissions, and (d) to assess changes in the same adverse events in hospitals that had not introduced...
... heterogeneous range of business establishments in the following categories: hotels, guesthouses, self-catering accommodation, bed and breakfasts, hostels, caravan and camp-sites, restaurants, activities ... population of Hispanics has already surpassed that of African Americans The structure of race in the US is changing dramatically and diversity issues are one of the major issues in understanding ... was considered to fulfil these criteria, insofar as it was Ireland s first local destination quality brand, and since its inception has gained widespread recognition as a successful tourism marketing,...
... antagonist (antivitamin) of folic acid aminosalicylates 5-Aminosalicylate and its derivatives (balsalazide, mesalazine, olsalazine, sulphasalazine) used in treatment of ulcerative colitis aminotransferase ... name of ptyalin) and pancreatic amylase are both α-amylases Major sources of α-amylase in the baking and brewing industries are Aspergillus oryzae (fungal amylase) and Bacillus subtilis, in addition ... gradually breaks down Used in soft drinks, dessert mixes and as a ‘table top sweetener’ Trade names Canderel, Equal, Nutrasweet, Sanecta Because aspartame contains phenylalanine, it is specifically...
... Loss Processing • UDT loss processing – Most loss are continuous – Record loss event other than lost packets – Access time is almost constant Access Time (us) 0 10 20 30 40 50 60 Loss Events ... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... Outline • • • • • TCP s inefficiency in grid applications UDT Design issues Implementations issues Conclusion and future work TCP and AIMD • TCP has been very successful in the Internet – AIMD (Additive...
... Technical Assessment Systems (TAS) (1989) Exposure Software Package Technical Assessment Systems, Washington, DC Theranaturals (2000) Theranaturals I3C Caps Available at http://www theranaturals.com ... (includes tissues of the nose, nasal turbinates, paranasal sinuses, and trachea); nrv, nervous system; orc, oral cavity (includes tissues of the mouth, oropharynx, pharynx, and larynx); ova, ovary; ... Press, Washington, DC National Research Council (1996) Carcinogens and Anticarcinogens in the Human Diet: A Comparison of Naturally Occurring and Synthetic Substances. Natl Acad Press, Washington,...
... book is also about maintaining and increasing the passion one originally had for being a professional in the healing arts Everything that initially attracted people to this fascinating, meaningful, ... workload, within shrinking financial and material resources Increasing consumerism has resulted in both increasing demands and expectations from patients In addition, doctors find themselves also accountable ... colleagues ina way that unnecessarily increases stress After Tacking on Dangerous Psychological Waters 23 Table 1-2 Conflicts with Peers, Staff, and Administrators Peer Conflict Schedules and calendars...
... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... yeast strain induced at 15 °C, and from yeast expressing SSTR2 as a control activity By taking advantage of structural and functional similarities between yeast and mammalian GPCR signaling pathways, ... expression vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...
... microcrystalline,comprising crystalline domains, noncrystalline domains, and possibly transitional regions Native starch granules 22 MIRTA NOEMI SIVAK A N D JACK PREISS have crystallinities estimated ... contains only amylopectin (and no amylose), but this starch has the same degree of crystallinity and the same X-ray pattern as the regular starches that contain both components Starch granules are ... harvest index; that is, a gradual increase in the proportion of above-ground assimilates going to the grains, the harvested sink organs The molecular bases for this ever-increasing harvest index...
... explorers and scientists to find their way about, since in addition to giving the derivation and affiliation and peculiar features of plants and animals, it contains references to the fascinating things, ... floating above the water ina rosy vapour; but as one draws nearer the yellow hills seem to be sailing on an ultramarine sea; the islands begin to spread out and rearrange themselves, and to assume ... u e A final e usually M and n are often nasal indicates that the vowel In Brazil a more clear-cut and is becomes an impure : Sem fim i, anda final = ssen^ f hin^ open, and usually emphasized...
... endophilin (Ringstad et al., 1997), intersectin (Zamanian et al., 2003), and sorting nexin (Ramachandran & Schmid, 2008) Actin binding proteins, such as cortactin and Abp1, also contain SH3 domain and ... The most frequent initial symptoms include foot drop, claw toe, and muscle wasting in the hands Symptoms in the advanced cases may include muscle waste in the hands and fore arms, neck and shoulder, ... – Advancesin Diagnostic and Therapeutic Approaches Yamada, H., Abe, T., Li, S .A. , Masuoka, Y., Isoda, M., Watanabe, M., Nasu, Y., Kumon, H., Asai, A & Takei, K (2009) Dynasore, a dynamin inhibitor,...
... illustrated by such words as abdomen, acclimate,appendicitis, candelabrum, data, finance, ignoramus, gratis, etc There are many words in our language about whose pronunciation the best orthoepists and lexicographers ... opinion among the authorities the fact is indicated by a star opposite these words It is a source of much satisfaction to know that many words, asalbumen, address, coadjutor, divan, horizon, harass, ... PREFACE Nothing so quickly or so certainly reveals the character of our culture and early associations as our speech The persistence of habits formed in youth, especially bad habits of pronunciation,...
... tools (Pintools) to install callbacks to inspect a program s instructions and routines, as well as intercept system calls and signals In Pin s terms, it allows the instrumentation of the application ... of additional software and setup, of previous solutions like ASSURE We propose REASSURE, a self-contained mechanism for healing software using RPs REASSURE assumes that a RP has already been identified, ... the adversary chooses a session as the test session and it is given a value, which is the session key of the session or a random value with probability The adversary continues the actions and at...
... Astrophysics, Mexico Alfonso Fernandez-Vazquez, National Institute of Astrophysics, Mexico Chapter.III Spectral-Based.Analysis .and. Synthesis.of.Audio.Signals 56 Paulo A. A Esquef, Nokia Institute ... physical, and sensory disabilities Advancesin Audio and Speech Signal Processing: Technologies and Applications, which includes contributions of scientists and researchers of several countries around ... problems such as the alaryngeal speakers In the first case, the signal processing device performs selective signal amplification on some specific frequency bands, ina similar form as an audio equalizer,...
... and grasping in healthy subjects andin individuals with hemiparesis by comparing movement kinematics of identical tasks made ina physical anda virtual environment Since reaching and grasping ... results [2-4] Neurophysiologists and rehabilitation specialists like physical and occupational therapists are beginning to be interested in VR as a tool to study motor control and to evaluate and ... humerus and the acromion (120 Hz, Optotrak Motion Analysis System, Northern Digital Corp.) Each trial was divided in two phases: 1) reaching and grasping the ball and 2) ball transport and release...
... conversions in BIBO are also accompanied by cascading quadratic processes To estimate the magnitude of those 72 Advancesin Lasers and Electro Optics Direct process Cascade process Type THG i SHG SFG ... materials Photonics materials such as glasses, optical crystals (LiNbO3, Al2O3, Y2O3) and semiconductors (Si, SiGe, SiC, GaN, etc.) are conventional materials for accomplishing lasing action (Polman ... solvents This section presents the nonlinear absorption of ICG obtained using single pulse and pulse train Z-scan techniques, both at 532 nm Using the single pulse Z-scan anda theoretical analysis...
... grating is generated; according to Eqs (20) and (23), the TWM gain gTWM is always negative and is symmetric around the axis of δ = If β ≠ 0, both a gain grating anda 110 Advancesin Lasers and ... opposite process of ”erasing” such wave train to go back to a flat, quasi CW, signal is also possible Indeed, it is easy to realize that this reverse process is well described ina similar way ... we assume that the frequencies of the 100 Advancesin Lasers and Electro Optics pump beam and the signal beam are different, i.e., a moving gain grating anda moving refractive index grating are...