adsorption+in+real+mixtures+far+from+demixing+a+kt+¼+1+4

... present in atrophic fiber where autophagy is active.) mir-206 (Assay n 43 73092), hsa- mir -18 1a (Assay n 43 7 311 7), hsa- mir -18 1b (Assay n 43 7 311 6), hsa- mir181c (Assay n 43 7 311 5), hsa- mir -13 3a (Assay ... following miRNAs: hsa- mir -1 (Assay n 43 7 316 1), hsa- Gambardella et al Journal of Translational Medicine 2 010 , 8 :48 http://www.translational-medicine.com/content/8 /1/ 48 Page of Table 1: Pathohistological ... n 43 7 3 14 2), hsa- mir -13 3b (Assay n 43 7 317 2), hsa- mir -10 3 (Assay n 43 7 315 8), hsa- mir -10 7 (Assay n 43 7 315 4) DM1 patients and control subjects have been included in this study Values of DM1 patients...

Ngày tải lên: 18/06/2014, 16:20

... asked [ iv ] 10 4 10 5 10 6 10 7 10 7 10 7 10 8 10 8 10 8 10 8 10 9 10 9 11 0 11 1 11 2 11 3 11 5 11 5 11 5 11 5 11 6 11 6 Table of Contents Different energy levels Use a mix of methods to communicate 11 6 11 6 Create ... formal training and education Summary References Chapter 3: Basic Skills, Traits, and Competencies of a Manager 36 36 38 39 39 40 40 41 41 42 43 44 44 44 45 45 46 46 47 Skills, traits, talents, and ... 2 41 2 41 242 242 242 242 243 Chapter 11 : Effective Planning Why plan? Making something happen Stopping something from happening Educating and making people aware Helping to prioritize Increasing...

Ngày tải lên: 23/03/2014, 13:20

... expression, a symbol, a chemical or mathematical formula, an acronym and so on A term in a specialized language is distinguished from a word in general language by its singlemeaning relationship (call ... Balloon mortgage Balloon and mortgage are two nouns which combined to creating compound noun “Balloon mortgage” that unlike a traditional mortgage, a balloon mortgage leaves a balance remaining ... Insurance Adjustable-Rate Mortgage Certificate of Reasonable Value Cost of Funds Index Fair Credit Reporting Act VA Federal Housing Administration Mortgage Insurance Mortgage Insurance Premium Principal,...

Ngày tải lên: 11/12/2013, 23:48

... 0. 013 9

Ngày tải lên: 14/02/2014, 06:20

... came in, and dinner began It was a hasty meal, as early dinner has to be when half of the day's work lies beyond it, and in less than half an hour Katherine was getting into a thick pilot coat, ... on again, covering his head, ears, and a good part of his face as well "Yes, I am ready, and rather keen on starting, for there is a damp smell coming in the air which may mean a slight thaw ... were a large number of sealing and walrus boats laid up in ice between Roaring Water Portage and Seal Cove Most of these had men living on board, who passed the days in loafing, in setting traps...

Ngày tải lên: 06/03/2014, 23:21

... pJF 119 EH(narGHIJ)Apr, as overexpressed wildtype plasmid [17 ] and pVA700-C16, pJF 119 EH(narGH[C1 6A] IJ)Apr, as plasmid lacking the high-potential [4Fe-4S] cluster [17 ] These were obtained with a ... corresponding to apparent rate constants are obtained by fitting Eqn (1) : DAbs ¼ a þ b eÀct 1 where, DAbs is the variation of absorbance, a and b are amplitude parameters and c is the time constant ... Reductant Em (mV) e (lM )1 cm )1) Artificial reductant Dithionite 0.069 ± 0.002 Menaquinone analogues Menadione Plumbagine Juglone Lapachol )1 ) 74 +33 )17 9 0.059 0. 043 0.037 0. 046 Ubiqinone analogues...

Ngày tải lên: 07/03/2014, 15:20

... 0 .4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced ... ⁄ 13 3.2 )11 7.5 ⁄ 13 4. 7 )90 .4 ⁄ )7.5 )11 7.8 ⁄ 12 0.9 )11 7.5 ⁄ )3.3 u⁄w )88 .1 ⁄ 13 7.6 )13 3.0 ⁄ 14 4. 5 )89.0 ⁄ 9.8 )16 3.7 ⁄ 14 5.3 )12 4. 9 ⁄ 0 .48 u⁄w )99.8 ⁄ 12 5.7 )16 2.8 ⁄ 14 6.9 )10 4. 4 ⁄ 0.72 ) 94. 5 ... P 212 1 21 P 212 1 21 a ¼ 31. 5 b ¼ 43 .0 c ¼ 88.0 56678 a ¼ 30.9 b ¼ 42 .9 c ¼ 87.5 6 310 4 9207 11 .8 (39.3) 13 .6 (2.8) 6.2 (5.0) 99.3 (92.5) 17 45 0 3.9 (5.0) 20.6 (11 .7) 3.7 (1. 9) 97.7 (82.6) 43 .85 1. 95...

Ngày tải lên: 07/03/2014, 17:20

... purchased from Amersham Pharmacia Biotech, USA AG1-X2 ion exchange resin was obtained from BioRad Crude methylisatoic anhydride, obtained from Aldrich, was recrystallized twice from hot acetone ... measured and averaged over five scans Data were analyzed by nonlinear least squares curve-fitting to standard binding isotherms by using the program KALEIDAGRAPH (Synergy Software) Similar titration ... TcdA in particular These substrate analogs are related to the commercially available methylanthraniloyl (mant) derivatives of ATP and GTP commonly used in mechanistic studies of ATPases and GTPases...

Ngày tải lên: 08/03/2014, 22:20

... construction of the poneratoxin gene [11 ] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... containing the recombinant poneratoxin are indicated with the arrow (C) Purified recombinant poneratoxin was analyzed on 20% SDS/PAGE and revealed with silver stain Lane 1, fractions no 49 – 51; lane...

Ngày tải lên: 30/03/2014, 13:20

... 1, 900 4, 3 24 1, 348 2,600 1, 43 4 1, 596 1, 570 1, 660 1, 550 1, 680 1, 500 1, 250 1, 142 1, 6 14 3,800 1, 500 3,000 1, 150 2,700 2 , 14 0 2,053 1, 100 1, 350 1, 300 1, 300 1, 49 0 6 ,40 0 1, 200 7,300 3,500 1, 075 1, 8 04 ... 20 01, Vol 61, No Table Job Classifications 19 91 and 19 98 State Number of classifications 19 91 Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware Florida Georgia Hawaii Idaho ... 1, 41 8 1, 100 2,782 1, 500 2, 318 5 51 2,258 1, 339 2,500 1, 280 1, 888 2 ,10 0 2,000 2,000 7 74 Number of classifications 19 98 1, 40 0 1, 500 1, 40 0 1, 8 54 4,500 9 51 2,600 1, 40 0 1, 537 2,355 1, 600 1, 40 0 1, 011 ...

Ngày tải lên: 12/06/2014, 19:31

... 34. 7 16 .4 94. 9 ± 14 .6 85.3 ± 19 .7 69.8 ± 32 .1 38.8 (1 12 ) 47 .2 ± 14 .2 47 .5 22 .4 ± 6.3 19 .0 17 .6 33.5 48 .9 16 .7 12 .2 57.0 21. 7 12 .7 24. 3 33.9 14 .5 96.5 ± 13 .3 87 .1 ± 18 .4 71. 1 ± 30.8 32.5 (1 12 ) 49 .3 ... mean value of 50 for the general population with a standard deviation of 10 Validation measures We used a number of validation measures available from the SAPALDIA database that met the Global ... Basel Stadt/Basel Landschaft, Geneva, Ticino and Zurich SAPALDIA Basel is part of the European Community Respiratory Health Survey 16 17 18 19 20 21 Milo A Puhan is supported by a career award...

Ngày tải lên: 18/06/2014, 22:20

... during the 2-minutes walking test was 10 0 (± 9), and 11 6 (± 11 ) respectively (p = 0 .13 4) At home, six patients walked independently without any walking aids and six typically used a walking aid ... 78 :15 06 - 14 39 Titianova EB, Peurala SH, Pitkanen K, Tarkka IM: Gait reveals bilateral adaptation of motor control in patients with chronic unilateral stroke Aging Clin Exp Res 2008, 20 :13 1 -13 8 doi :10 .11 86 /17 43 -0003-8-23 ... further away from reflect increasingly impaired bilateral coordination Impairments in gait asymmetry and bilateral coordination of gait in stroke patients The gait of the stroke patients is characterized...

Ngày tải lên: 19/06/2014, 08:20

... ever having mixed amalgam manually in a mortar may be explained by some misunderstanding and unclear wording in the questionnaire The method, “mixing amalgam manually in a mortar”, was meant from ... expressed as kappa statistics between the questionnaire and the interview in regard to ever having used copper amalgam, performed manual mixing in a mortar, and used a Dentomat Taking the answers from ... 15 .5 4. 2 5.5 4. 9 6.7 0.0 0.0 4. 0 2.0 14 .4 18 .4 5.5 4. 9 0.0 5.0 12 .9 7 .4 3.5 4. 9 4. 2 0.6 0.0 7.0 4. 5 15 .7 9 .4 6.5 4. 9 All ( 24) 19 76 Both dental nurses (10 ) One dentist and one dental nurse (13 )...

Ngày tải lên: 20/06/2014, 00:20

... binary classifier partitions input data objects into two classes, a “yes” class H and a “no” class H A binary classifier chain is a special case of a binary classifier tree, where multiple binary ... determine bounds for being in each state and are not regarded as the average utilities estimated in each EURASIP Journal on Advances in Signal Processing 13 Table 2: Detection and false alarm tradeoff ... [11 ] D S Turaga, O Verscheure, U V Chaudhari, and L D Amini, “Resource management for networked classifiers in EURASIP Journal on Advances in Signal Processing [12 ] [13 ] [ 14 ] [15 ] [16 ] [17 ] [18 ]...

Ngày tải lên: 21/06/2014, 19:20

... M: An evaluation of the Kessner adequacy of prenatal care index and a propose adequacy of prenatal care utilization index Am J Public Health 19 94, 84( 9) : 14 14 14 20 26 Kogan MD, Martin JA, Alexander ... Cátia Regina Branco da Fonseca,Aff1 Corresponding Affiliation: Aff1 Email: catiafonseca@fmb.unesp.br Maria Wany Louzada Strufaldi,Aff2 Email: mwany@uol.com.br Lídia Raquel de Carvalho,Aff3 Email: ... period in the denominator ( 844 2) [17 ,22] Data on 17 20 newborns included in the study were obtained in LBC and information on 10 49 pregnant women ( 61% ) from medical charts in BHU and UH, in which 48 .7%...

Ngày tải lên: 21/06/2014, 19:20

... 2 .1 19.28 ± 3.73 717 ± 11 0 3 74 ± 65 4. 99 ± 0.02 9.97 ± 0. 04 7. 51 ± 0.96 14 .46 ± 1. 81 4. 67 ± 1. 02 7.89 ± 1. 48 7.2 ± 1. 55 13 . 21 ± 3.02 875 ± 10 5 5 14 ± 85 20% 19 . 84 ± 0 .17 16 . 14 ± 2.23 10 .19 ± 1. 86 ... 1. 86 46 .48 ± 7.83 19 2 ± 26 19 .87 ± 0 . 14 18 .16 ± 3 .46 9.72 ± 2 .48 29.52 ± 6.9 238 ± 43 19 .86 ± 0 .15 21. 94 ± 1. 89 14 .06 ± 1. 71 42 .36 ± 6.92 19 6 ± 27 19 .88 ± 0 .12 25. 94 ± 3.08 15 .27 ± 2 .43 27. 34 ± ... ± 1. 53 5 51 ± 65 8 .15 ± 0.97 17 .66 ± 2. 91 311 ± 46 16 .59 ± 1. 58 36.69 ± 6 .11 17 4 ± 29 4. 97 ± 0.03 9.93 ± 0.07 19 .77 ± 0. 21 WWPRDw PRD RMS 7.26 ± 0.79 4. 42 ± 0.77 6.53 ± 1. 16 13 . 91 ± 1. 43 8 . 14 ...

Ngày tải lên: 22/06/2014, 23:20

... questionnaire is obtained with 20 Vietnamese participants (10 males and 10 females) and 20 English participants (10 males and 10 females) including American, Australian, Canadian and English 20 participants ... life and his/her ways of living and thinking Brown (19 94: 16 5) describes that a language is a part of a culture and a culture is a part of a language; the two are intricately interwoven so that ... participants including American, Australian, Canadian and English The interview is also delivered to 20 English participants and 20 Vietnamese participants The participants for questionnaire and interview...

Ngày tải lên: 27/07/2014, 18:51

Ngày tải lên: 08/08/2014, 18:20

... covariates that Baseline data During the observational period, a total of 1, 1 61 patients were enrolled in the study Demographic data and clinical characteristics of patients studied are summarised ... significance 2.83 (2.27; 3. 54) p < 0.0 01 1 .48 (1. 19; 1. 85) p < 0.0 01 1.33 (1. 08; 1. 55) p = 0. 017 1. 10 (0.86; 1. 40 ) p = 0 .44 8 HR (95% CI) Level of significance 2 . 14 (1. 61; 2. 84) p < 0.0 01 1.75 (1. 28; ... MTX A Number Age (years) Female Disease duration (months) HAQ score 5 01 55.0 (13 .6) 74% 13 3.5 (11 3.8) 1. 34 (0.62) Etanercept II Other DMARD B Mono-therapy C 11 6 10 4 57 .4 (12 .0) 61. 0 (12 .1) 75%...

Ngày tải lên: 09/08/2014, 08:23

... (5-methyl -1- phenyl-2-[1H]-pyridone), a novel anti-fibrosing agent, in myelofibrosis with myeloid metaplasia Br J Haematol 20 01, 11 4 (1) :11 1 -11 3 Krupp LB, LaRocca NG, Muir-Nash J, Steinberg AD: The fatigue ... ameliorates bleomycin-induced lung fibrosis in hamsters J Lab Clin Med 19 95, 12 5(6):779-785 Garcia L, Hernandez I, Sandoval A, Salazar A, Garcia J, Vera J, Grijalva G, Muriel P, Margolin S, Armendariz-Borunda ... data analysis and drafting the manuscript All authors have read and approved the final version of this manuscript Acknowledgements This research was supported in part by the Intramural Research...

Ngày tải lên: 09/08/2014, 10:21