... dear Gräuben was there; so I said nothing, and could eat nothing At half-past five there was a rattle of wheels outside A large carriage was there to take us to the Altona railway station It was ... side, and falls gently towards the sea On the other extends the vast bay of Faxa, shut in at the north by the enormous glacier of the Snæfell, and of which the Valkyria was for the time the only ... are made of earth and turf, and the walls slope inward; they rather resemble roofs placed on the ground But then these roofs are meadows of comparative fertility Thanks to the internal heat, the...
Ngày tải lên: 17/02/2014, 04:20
... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, the xb101+ ... the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas acidovorans plasmid Agarose gel (A) and Southern blot (B) analyses of ... concentrations The second primer was derived either from the known 5¢ end of the xdhA gene (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes...
Ngày tải lên: 16/03/2014, 23:20
A Journey into the Center of the Earth potx
... dear Gräuben was there; so I said nothing, and could eat nothing At half-past five there was a rattle of wheels outside A large carriage was there to take us to the Altona railway station It was ... side, and falls gently towards the sea On the other extends the vast bay of Faxa, shut in at the north by the enormous glacier of the Snæfell, and of which the Valkyria was for the time the only ... are made of earth and turf, and the walls slope inward; they rather resemble roofs placed on the ground But then these roofs are meadows of comparative fertility Thanks to the internal heat, the...
Ngày tải lên: 23/03/2014, 00:20
báo cáo khoa học: "Retroperitoneal liposarcomas: the experience of a tertiary Asian center" pps
... symptoms as a result of mass effect namely bilateral lower limb edema and urinary frequency An abdominal mass was palpable in the majority, 16 of the patients at presentation (76%) Of these, 13 ... features e.g the emphasis on the histological type and the evaluation of the amount of necrosis Neither of the systems is endorsed solely by the Association of Directors of Anatomic and Surgical ... Page of Table Risk factors for overall survival and disease free survival after operation (p-values of the Tarone-ware test are presented) Risk factors 3-year survival rate 5-year survival rate...
Ngày tải lên: 09/08/2014, 01:24
tác phẩm văn học của tác giả Verne jules tác phẩm a journey to the center of the earth
... follow the natural pathway made of lava I was surprised and glad that it was as easy a walk down as if we were going down stairs in an old German house Hans had walked farther ahead After six hours, ... weak voice and cried out, “Hans is leaving us! Hans, if you are a man, come back.” My words were too soft to be heard I was ashamed at my suspicions of a man who had always behaved admirably Hans ... crater of Yocul of Sneffels, which the shade of Scartaris caresses, before the kadends of July, audacious traveler, and you will reach the center of Earth I did it Arne Saknussemm My uncle leaped...
Ngày tải lên: 09/03/2016, 20:44
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...
Ngày tải lên: 12/09/2012, 15:05
List the components of a radio system
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...
Ngày tải lên: 13/09/2012, 10:52
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...
Ngày tải lên: 21/09/2012, 10:39
Guest the meaning of a word
... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...
Ngày tải lên: 02/10/2012, 12:07
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...
Ngày tải lên: 25/10/2012, 11:00
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... engages mainly in the industry of household appliances, as well as the domains of real estate and logistics The group is also one of the largest manufacturing and exportation bases of electric appliances ... Generally, if possible, it is wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade ... days after of the buyer’s advice ARTICLE 8: ARBITRATION During the performance of the contract, if any dispute arises, the parties shall discuss to find solution in an amicable way If the parties...
Ngày tải lên: 18/04/2013, 08:57
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater
... water ascends to the top of the tank It is originated from the fact that, after gaining heat from the solar radiation, the tank wall heats a thin vertical layer of water along the tank wall Part ... function of the density, specific heat capacity and the initial and massweighted average temperatures of water; with all the values, apart from the mass-weighted average temperature, are the same ... solar radiation and average temperature of the present experimental study and the theoretical results of [1] in January Figure 12 The time variation of solar radiation and stored energy of the...
Ngày tải lên: 05/09/2013, 15:28
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...
Ngày tải lên: 06/09/2013, 05:48
Tài liệu The message of a master - By John McDonald pdf
... the great masses of humanity are using the Law destructively, or partially so, and the scales are balanced against them Here and there, among the masses, we find an occasional outstanding figure ... inferior creatures as the beasts of the field, the birds of the air and the fish of the sea are bountifully supplied For any man, no matter what his station in life, to take the stand that it is the ... we know what we are talking about when we speak of the chaos of thoughts in the air http://www.RetrieveALover.com Page 33 The Message of a Master On the other hand, the man who has a set definite...
Ngày tải lên: 15/12/2013, 06:15
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, in the book The Experience Economy (1999), authors ... mirrors the myriads of interactions taking place in a company and the value created in each of them The problem is not the amount of relationships since firms have the help of sophisticated information ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar...
Ngày tải lên: 20/12/2013, 17:15
Tài liệu Exporting the Results of a Query as a String docx
... is the TAB character rowDelimiter The character or characters that separate rows The default value is the CARRIAGE RETURN character nullExpr A string that is substituted for null column values ... If a number larger than the number of records in the table is specified, all records are converted without error columnDelimiter The character or characters that separate columns The default value ... corresponding to the rows selected from the table dt The DataTable to convert to a string numRows The number of rows in the table to convert If this number is negative, all rows in the table are converted...
Ngày tải lên: 24/12/2013, 05:15
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The ... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...
Ngày tải lên: 03/01/2014, 19:44
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx
... and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... clearly consider CSM as an activity that is based on standardized questionnaires that are delivered to a sample of the customer base These quantitative multi-attribute questionnaires are then analyzed ... important to differentiate whether CSM is focusing on the satisfaction of the customer organization as a whole or the satisfaction of certain individuals within that organization These are clearly...
Ngày tải lên: 15/01/2014, 15:59
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... with their work The results are valued on a Likert scale of to for the different items Over the last few years, the average satisfaction index—calculated as the average of the values given to each ... be measured via these same factors, even if the individual case is a strategy for which new tools are used The analysis revealed that one of the essential organizational factors, because of its ... Irizar Brazil and Irizar Mexico, with a shareholding in International Hispacold, all to be able to service the growing demand in these markets At the same time, a systematic application of KM was...
Ngày tải lên: 24/01/2014, 00:20