adipose tissue as a target for dehydroepiandrosterone and its sulfate

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham ... Schizophrenia and Depression (JAB), the National Institute of Mental Health (ACN and RWG), the Department of Defense (JAB and AAF), the Department of Veterans A airs (RWG), and the Ella McFadden Charitable ... translational regulation, rate of turnover, subcellular localization, or association with as yet undefined regulatory factors The most abundant nucleoside kinase in mammals, AK has emerged as a key...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... tat, rev and nef mRNAs [9], which are transported to the cytoplasm for translation of the Tat, Rev and Nef proteins (Fig 2) All the tat mRNAs are spliced at site A3 The rev mRNAs are spliced at ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo lâm nghiệp: "Wedge prism as a tool for diameter and distance measurement" ppsx

Báo cáo lâm nghiệp: "Wedge prism as a tool for diameter and distance measurement" ppsx

... of the angle gauge (b) b a (a) α borderline Table Average values and their differences Diameter measured optically with wedge prism Diameter measured with calliper Difference Standard deviation ... method was also described for determining the tree diameter at breast height (Bitterlich 1996) For testing the accuracy of the method the laser telemeter was used and then the measured diameter was ... the distance when the blocks were on the borderline The distance was measured using the laser telemeter with half -a- meter scale The diameter was calculated and compared with the control measure...

Ngày tải lên: 07/08/2014, 10:21

4 444 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

... self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease J Exp Med 1985, 161:72-87 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, Sakaguchi S: Naturally anergic and ... allogeneic organ transplants Acknowledgements This research was supported in part by National Institutes of Health grant AI 41768, The Nora Eccles Treadwell Foundation, and the Arthritis Foundation-Southern ... Sakaguchi S, Fukuma K, Kuribayashi K, Masuda T: Organ-specific autoimmune diseases induced in mice by elimination of T cell subset I Evidence for the active participation of T cells in natural...

Ngày tải lên: 09/08/2014, 03:24

6 409 0
báo cáo khoa học: "Nanopores: maltoporin channel as a sensor for maltodextrin and lambda-phage" pdf

báo cáo khoa học: "Nanopores: maltoporin channel as a sensor for maltodextrin and lambda-phage" pdf

... Membrane current was measured via homemade Ag/AgCl electrodes One electrode was used as ground and the other connected to the headstage of an Axopatch 200B amplifier (Axon Instruments, USA), allowing ... maltooligosaccharides bound to Maltoporin reveal a specific sugar translocation pathway Structure 1996, 4:127-134 Roa M, Scandella D: Multiple steps during the interaction between coliphage lambda and its ... side of Maltoporin addition The average residence time is 5.0 ms (C) First, M6-ANDS was injected to the trans-side and no variation in the ion current occurs As control, maltohexaose was added to...

Ngày tải lên: 11/08/2014, 00:22

6 251 0
báo cáo khoa học: " Cannabis as a substitute for alcohol and other drugs Amanda Reiman" pps

báo cáo khoa học: " Cannabis as a substitute for alcohol and other drugs Amanda Reiman" pps

... [12] Cannabis substitution has also been discussed as part of a harm reduction framework A record review of 92 medical cannabis patients who used marijuana as a substitute for alcohol was conducted ... information, cannabis use pattern, alcohol and drug use and service utilization Participants were asked the quantity and frequency of alcohol, tobacco and drug (prescription and illicit) use as ... as well as current and past alcohol and/ or drug treatment Participants were also asked about whether they use cannabis as a substitute for alcohol, illicit drugs or prescription drugs and why...

Ngày tải lên: 11/08/2014, 18:20

5 278 0
Intercultural performance as a paradigm for identity and discourse

Intercultural performance as a paradigm for identity and discourse

... interculturalism have affected and effected our understanding and theorizing of past and present Asian (intercultural) Shakespeare performances For instance, is there value in naming Asian Shakespeare as ... intercultural Shakespeare from other Shakespearean adaptations and appropriations? How does the interaction between Shakespeare and varied Asian performance practices, styles and cultures inform and affect ... of Shakespeare in Japan, China and Singapore Such a comparative analysis sheds light on the diverse reasons for and approaches to appropriating Shakespeare in Asia, and provides a historical overview...

Ngày tải lên: 16/10/2015, 15:37

131 617 0
RESEARCH ON PLANT DIVERSITY IN FOREST ECOSYSTEMS OF XUAN SON NATIONAL PARK  IN PHU THO PROVINCE AS a BASIS FOR PLANNING  AND CONSERVATION WORK

RESEARCH ON PLANT DIVERSITY IN FOREST ECOSYSTEMS OF XUAN SON NATIONAL PARK IN PHU THO PROVINCE AS a BASIS FOR PLANNING AND CONSERVATION WORK

... Representatives are often families of Rosaceae, Lauraceae, Apocynaceae, Theaceae, Magnoniaceae, Juglandaceae, Fagaceae, Aceraceae, etc (6) Xuan Son National Park has high differentiation on vegetation ... rice-leaf weeds such as Thysanolaena maxima, Saccharum arundicaceum, Miscanthus nepalensis, Miscanthus japonica, Miscanthus japonica, Saccharum spontaneum, Sasa spp., Neyraudia reynaudiana, etc ... BIGNONIACEAE Markhamia cauda-felina (Hance) Craib Fernandoa brilletii (P.Dop) Steenis BURSERACEAE Canarium tonkinensis L CAESALPINIACEAE Senna siamea Lam DIPTEROCARPACEAE Hopea chinensis (Merr.) Hand.-Mazz...

Ngày tải lên: 21/07/2016, 10:39

27 532 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... Hedonic ratings In the pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than ... than the sample with regular aroma concentration The hypothesis was based on studies by De Graaf et al (1994, 1996) and Griep, Mets, and Massart (1997) and Schiffman and Warwick (1993), all of whom...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training ... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... General Atlanta, GA, Dept of Health and Human Services, Center for Disease Control, antional Center for Chronic Disease Preventation and Health Promotion, Office of Smoking and Health, Washington, ... screen (Table 1) were previously thought to be safe and are included on the FEMA GRAS list (Flavor and Extract Manufacturers' Association – Generally Regarded As Safe) and the FDA EAFUS list...

Ngày tải lên: 05/03/2014, 17:20

17 733 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, and fusidic acid-resistant mutants of elongation factor ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... structures demonstrate large conformational changes in the eukaryotic ribosomal translocase Nat Struct Biol 10, 379–385 Al Karadaghi S, Aevarsson A, Garber M, Zheltonosova J & Liljas A (1996) The structure...

Ngày tải lên: 06/03/2014, 22:21

15 475 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have ... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... from Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the field of regenerative medicine...

Ngày tải lên: 22/03/2014, 17:20

12 550 0
Testof English as a Foreign Language™ Information and Registration BULLETIN for Computer-based and Paper-based Testing pptx

Testof English as a Foreign Language™ Information and Registration BULLETIN for Computer-based and Paper-based Testing pptx

... 113 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... 416 Afrikaans Albanian Amharic Arabic Armenian Assamese Azeri Bashkir Basque (Euskara) Belarusian Bemba Bengali Berber Bhili Bikol Bulgarian Burmese Buyi Catalan Cebuano (Visayan) Chichewa Chinese ... Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Brazil British Virgin Islands Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African...

Ngày tải lên: 02/04/2014, 05:20

28 970 0
Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

... waste was applied before planting as was 50 % of the inorganic P and K The remaining P and K was applied at panicle initiation stage at 35 days after sowing (DAS) while N was split times (7, 20 and ... (Page et al 1982), plant analysis (Chapman and Pratt, 1961); water and wastes samples analysis followed methods for chemical analysis of water and wastes (MCAWW) EPA/600/4/79-020 revised March ... within a Decade Catfish Aquaculture in Asia: Present Status and Challenges for Sustainable Development Handbook and Abstracts from Conference at CanTho University, CanTho City, Vietnam p 25 Pillay,...

Ngày tải lên: 21/06/2014, 04:20

24 346 0
Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx

Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx

... tsom si ydalam siht dna sulahpecordyh latinegnoc ot desopsiderp era sauhauhihC aixata htiw detneserp saw muiravlac depahs-emod a htiw god auhauhihC a ,esac siht nI ]3[ erusserp lainarcartni eht ... .)daehworra( ytivac laenotirep eht dna )worra( elcirtnev laretal tfel eht otni decalp saw tnuhs PV ehT edimalozateca ,enosahtemaxed htiw detaert saw god ehT ]01[ ellenatnof tnetsisrep a ro daeh ... tcudeuqa cilahpecnesem deworran a evlovni sulahpecordyh latinegnoc fo sesac rehtO etar etauqeda na ta FSC brosbaer ot illiv dionhcara eht fo eruliaf ot eud yltnerappa giF si sulahpecordyh )latinegnoc(...

Ngày tải lên: 07/08/2014, 18:21

4 384 0
Báo cáo y học: "Targeting Toll-like receptor signaling in plasmacytoid dendritic cells and autoreactive B cells as a therapy for lupus" pps

Báo cáo y học: "Targeting Toll-like receptor signaling in plasmacytoid dendritic cells and autoreactive B cells as a therapy for lupus" pps

... 34 Tan EM: Antinuclear antibodies: diagnostic markers for autoimmune diseases and probes for cell biology Adv Immunol 1989, 44:93-151 35 Casciola-Rosen LA, Anhalt G, Rosen A: Autoantigens targeted ... decreased DNA methyltransferase activity [89] secondary to cellular activation [116] Interestingly, medications that can cause drug-induced lupus (e.g hydralazine and procainamide) are capable ... chromatin complexes, aberrant DNA methylation, oxidative DNA damage, differential cleavage of DNA, and histone phosphorylation are just a few modifications that may result in increased TLR stimulation...

Ngày tải lên: 09/08/2014, 07:20

11 552 0
Báo cáo y học: "Impaired expression of mitochondrial and adipogenic genes in adipose tissue from a patient with acquired partial lipodystrophy (Barraquer-Simons syndrome): a case report" pot

Báo cáo y học: "Impaired expression of mitochondrial and adipogenic genes in adipose tissue from a patient with acquired partial lipodystrophy (Barraquer-Simons syndrome): a case report" pot

... manuscript RRG, EG and II performed the analysis and interpretation of data in relation to renal and liver function, cytogenetic analysis and blood analysis EGA and ALA carried out muscle analysis ... RNA extraction using a column-affinity based methodology The patient was a Caucasian woman from Spain, and who was the first child of non-consanguineous, healthy parents The neonatal period and ... Foster City, CA, USA) One microgram of RNA was transcribed into cDNA using random-hexamer primers and real-time reverse transcriptasepolymerase chain reaction (RT-PCR) was performed on an ABI PRISM...

Ngày tải lên: 11/08/2014, 21:22

6 329 0
Báo cáo y học: " Airway smooth muscle as a target of asthma therapy: history and new directions" docx

Báo cáo y học: " Airway smooth muscle as a target of asthma therapy: history and new directions" docx

... reveal other therapeutic approaches for dealing with airway bronchospasm Approaches designed to decrease ASM mass per se A radically different approach would be to ablate the ASM itself, rather ... understanding and treating asthma has been the lack of a good animal model of asthma Asthma is characterized, in part, by AHR, reversible bronchoconstriction, wheezing, inflammation, and cellular ... for the future As stated above, there have not been any substantially new pharmacological advances in the past decade or two with respect to treatment strategies for asthma which target the ASM...

Ngày tải lên: 12/08/2014, 16:20

12 358 0
Báo cáo y học: "The Mammalian Phenotype Ontology as a tool for annotating, analyzing and comparing phenotypic information" potx

Báo cáo y học: "The Mammalian Phenotype Ontology as a tool for annotating, analyzing and comparing phenotypic information" potx

... vascular defects abnormal vasculature o abnormal vascular dilation noted at E8.5 o vascular dilation was associated with an increased endothelial proliferation rate o in addition to the dilation, ... [14] In addition, MGD has adopted the Mouse Embryo Anatomy Nomenclature Database [15] and the Anatomical Dictionary for the Adult Mouse [16] for annotating data that include anatomical attributes, ... serves as the authoritative source for the names and symbols associated with mouse genes, alleles and strains The advantage of applying such nomenclatures has been increasingly recognized as genomes...

Ngày tải lên: 14/08/2014, 14:21

9 265 0
w