adipose tissue as a source of mesenchymal stem cells

báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and ... regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential role in innate immunity by catalyzing the formation of superoxide...

Ngày tải lên: 19/06/2014, 22:20

12 413 0
Báo cáo y học: "An in vitro study investigating the survival and phenotype of mesenchymal stem cells following injection into nucleus pulposus tissue" pot

Báo cáo y học: "An in vitro study investigating the survival and phenotype of mesenchymal stem cells following injection into nucleus pulposus tissue" pot

... Hiyama A, Mochida J, Iwashina T, Omi H, Watanabe T, Serigano K, Tamura F, Sakai D: Transplantation of mesenchymal stem cells in a canine disc degeneration model J Orthop Res 2008, 26:589-600 Page ... chitosan-glycerophosphate hydrogels Biomaterials 2008, 29:85-93 28 Sakai D, Mochida J, Iwashina T, Watanabe T, Nakai T, Ando K, Hotta T: Differentiation of mesenchymal stem cells transplanted to a ... Mochida J, Iwashina T, Hiyama A, Omi H, Imai M, Nakai T, Ando K, Hotta T: Regenerative effects of transplanting mesenchymal stem cells embedded in atelocollagen to the degenerated intervertebral...

Ngày tải lên: 09/08/2014, 01:22

10 434 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

... KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation ... et al.: Feasibility of allogeneic hematopoietic stem cell transplantation for autoimmune disease: position statement from a National Institute of Allergy and Infectious Diseases and Page of 10 ... Marrow Transplant 2004, 33:597-604 23 Maccario R, Podesta M, Moretta A, Cometa A, Comoli P, Montagna D, Daudt L, Ibatici A, Piaggio G, Pozzi S, et al.: Interaction of human mesenchymal stem cells...

Ngày tải lên: 09/08/2014, 08:23

10 559 0
Báo cáo y học: " Curcumin mediated suppression of nuclear factor-κB promotes chondrogenic differentiation of mesenchymal stem cells in a high-density co-culture microenvironment" pdf

Báo cáo y học: " Curcumin mediated suppression of nuclear factor-κB promotes chondrogenic differentiation of mesenchymal stem cells in a high-density co-culture microenvironment" pdf

... longa is a promising therapeutic agent for the treatment of OA and RA as it has pro-apoptotic properties in synovial lining cells [33,34] and has been shown to have anti-inflammatory and anti-apoptotic ... cascade by IL-1β in MSCs, cultures were evaluated for activated caspase-3 and the marker of inflammation and prostaglandin production COX-2 (Figure 3D) Production of activated caspase-3 and COX-2 ... cultures were evaluated for activated caspase-3 and the marker of inflammation and prostaglandin production COX-2 (Figure 4D) Activated caspase-3 and COX-2 were highly expressed in untreated MSC cultures...

Ngày tải lên: 12/08/2014, 14:22

15 328 0
Báo cáo khoa học: "omputer tomographic investigation of subcutaneous adipose tissue as an indicator of body composition" pot

Báo cáo khoa học: "omputer tomographic investigation of subcutaneous adipose tissue as an indicator of body composition" pot

... region scanned was also determined The ratio of the volume of adipose tissue to total volume expressed as a percentage (fat-index) was calculated, taken as an indicator of general adiposity and used ... individual peaks, one for adipose tissue and another for non -adipose soft tissues By examining the areas under the curve for adipose tissue, the total adipose tissue volume was determined A detailed ... sum and range of these values for the three scans at each measure point was displayed in tabular form A search was made for measure points where both the sum of correlation coefficients was maximal...

Ngày tải lên: 12/08/2014, 18:22

6 188 0
examining linguistic ambiguity as a source of constructing funniness in english verbal jockes = khảo sát hiện tượng mơ hồ ngôn ngữ với vai trò là một nguồn tạo nên tính hài hước của các câu chuyện tếu tiếng anh

examining linguistic ambiguity as a source of constructing funniness in english verbal jockes = khảo sát hiện tượng mơ hồ ngôn ngữ với vai trò là một nguồn tạo nên tính hài hước của các câu chuyện tếu tiếng anh

... chapter in fact is a typical example of this (2) A man eating a kebab goes up to a lady who has a yapping Chihuahua at her heels “Can I throw your dog a bit?” he asked politely “Certainly,” came ... considered ambiguous if and only if it has at least two paraphrases that are not themselves paraphrases of one another A good case in point can be found in: (3) The chicken is ready to eat It is ... conveying at least two incompatible interpretations- “having more than one sense” as stated by Hurford and Heasley (2001:121) -9- Regarding paraphrasing, Hurford and Heasley (2001) assert that a word...

Ngày tải lên: 02/03/2015, 14:32

85 622 1
Transplantation of mesenchymal stem cells for the treatment of parkinsons disease in a mouse model

Transplantation of mesenchymal stem cells for the treatment of parkinsons disease in a mouse model

... neurons and respond to various stimuli such as disease, chemicals or physical damage, microglia also act as scavenger cells in the event of infection, inflammation, trauma, ischaemia and neurodegeneration ... ligase that is involved in the proteasomal degradation of target proteins (Hattori et al., 2000; Yao et al., 2004) Several putative substrates of Parkin have been identified, and accumulation of ... cell transplantation attenuates blood brain barrier damage and neuroinflammation and protects dopaminergic neurons against MPTP toxicity in the substantia nigra in a model of Parkinson’s disease...

Ngày tải lên: 11/09/2015, 09:05

200 311 0
Food as a Source of Dioxin Exposure in the Residents of Bien Hoa City, Vietnam

Food as a Source of Dioxin Exposure in the Residents of Bien Hoa City, Vietnam

... Channa Striata—snakehead Anabas Testudineus— climbing perch Clarias Fuscus— catfish Clarias Fuscus— catfish Ostechilus Hasselti— carp Discussion This is the most recent VietnamU.S collaborative ... 3.3 40 74 2.9 0.95 68 Channa Striata—snakehead Anabas Testudineus— climbing perch Clarias Fuscus— catfish Clarias Fuscus— catfish Ostechilus Hasselti— carp TABLE Comparison of Highest Dioxin TEQ ... Foundation, and the Zumwalt Institute for Public and Environmental Health This article was prepared with the assistance of Joanna McKey and K C Tung We also wish to acknowledge the past collaboration...

Ngày tải lên: 27/06/2016, 20:28

8 513 1
báo cáo hóa học:" Targeting of mesenchymal stem cells to ovarian tumors via an artificial receptor" docx

báo cáo hóa học:" Targeting of mesenchymal stem cells to ovarian tumors via an artificial receptor" docx

... Therapy, Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama 35294- 2172, USA, 2Division of Human Gene Therapy, Department of Pathology, University of Alabama at Birmingham, ... Birmingham, Birmingham, Alabama 35294- 2172, USA, 3Division of Human Gene Therapy, Department of Surgery, University of Alabama at Birmingham, Birmingham, Alabama 35294- 2172, USA, 4Division of Human ... Bender HG, Dall P, Stoff A, Pereboeva L, Curiel DT: Mesenchymal stem cells as a vehicle for targeted delivery of CRAds to lung metastases of breast carcinoma Breast Cancer Res Treat 2007, 105(2):157-67...

Ngày tải lên: 20/06/2014, 07:20

14 339 0
Báo cáo khoa học: "In vitro neuronal and osteogenic differentiation of mesenchymal stem cells from human umbilical cord blood" ppt

Báo cáo khoa học: "In vitro neuronal and osteogenic differentiation of mesenchymal stem cells from human umbilical cord blood" ppt

... gnitaitnereffid fo elbapac era segahporcam dna setyconom erutam :stsalcoetso fo nigirO T aduS ,JT nitraM ,T agoK ,T arahihsiN ,T ikasaS ,H akanaT ,T ustakA ,N ihsahakaT ,N awagadU 52 373-763 ,691 ... elbatnalpsnart fo ecruos a sa doolb droc lacilibmu namuH H akoareT ,T uzimusaY ,K esakaT ,C otaS ,S iirA ,K otomareT ,Y araH ,K otiaS-uzimihS ,M ebanataW ,R ieznihC ,Y akanaT ,S amunikaK 31 213-592 ,46 ... yreve degnahc saw muidem ehT ]21,9[ gnitalp retfa h 42 deilppa saw )]ASU ,amgiS[ etahpsohporecylg-β l/lomm 01 dna ]ASU ,amgiS[ etahpsohp-2-dica cibrocsa l/lomm 50.0 ,]ASU ,amgiS[ enosahtemaxed l/lomµ...

Ngày tải lên: 07/08/2014, 18:21

6 410 0
Báo cáo y học: "Microenvironmental changes during differentiation of mesenchymal stem cells towards chondrocytes" ppt

Báo cáo y học: "Microenvironmental changes during differentiation of mesenchymal stem cells towards chondrocytes" ppt

... simultaneous quantitative analysis of 384 mRNA transcripts The data have been assembled into a biological process-oriented database, serving as a model for the cartilage MSC niche Materials and ... S, Piacentini A, Cavallo C, Caplan AI, Facchini A: Hyaluronan-based polymer scaffold modulates the expression of inflammatory and degradative factors in mesenchymal stem cells: Involvement of Cd44 ... 144:2480-2488 Tamamura Y, Otani T, Kanatani N, Koyama E, Kitagaki J, Komori T, Yamada Y, Costantini F, Wakisaka S, Pacifici M, et al.: Developmental regulation of Wnt/beta-catenin signals is required...

Ngày tải lên: 09/08/2014, 10:20

12 390 0
báo cáo khoa học: " The HPB-AML-I cell line possesses the properties of mesenchymal stem cells" ppt

báo cáo khoa học: " The HPB-AML-I cell line possesses the properties of mesenchymal stem cells" ppt

... Menendez P, Catalina P, Rodriguez R, Melen GJ, Bueno C, Arriero M, GarciaSanchez F, Lassaletta A, Garcia-Sanz R, Garcia-Castro J: Bone marrow mesenchymal stem cells from infants with MLL-AF4+ acute ... Adhikari AS, Agarwal N, Wood BM, Porretta C, Ruiz B, Pochampally RR, Iwakuma T: CD117 and Stro-1 identify osteosarcoma tumor-initiating cells associated with metastasis and drug resistance Cancer ... [15], was obtained from the Japanese Collection of Research Bioresources (JCRB, Osaka, Japan) and propagated in a T-75 flask in a total number of 1.5 × 10 cells Cell culture was maintained in...

Ngày tải lên: 10/08/2014, 10:20

9 284 0
báo cáo khoa học: " Efficacy of Mesenchymal Stem Cells in Suppression of Hepatocarcinorigenesis in Rats: Possible Role of Wnt Signaling" doc

báo cáo khoa học: " Efficacy of Mesenchymal Stem Cells in Suppression of Hepatocarcinorigenesis in Rats: Possible Role of Wnt Signaling" doc

... ttcctgcaatagtgtctcagttg - right: aaagggctgcagctttgtta 3-PCNA: - left: gaactttttcacaaaagccactc - right: gtgtcccatgtcagcaatttt 4-Survivin: - left: gagcagctggctgcctta - right: ggcatgtcactcaggtcca Analysis ... upregulate the mRNA expression of cell-cycle negative regulator p21 and apoptosis-associated protease caspase-3, resulting in a G0/G1 phase arrest and apoptotic cell death of tumor cells[ 64] They also ... late Professor Dr Yassin Abdel Ghaffar and Wife (HCC GRANT) Special thanks to Professor Dr Tawhida Yassin Abdel Ghaffar; Professor of Pediatric Hepatology, Faculty of Medicine, Ain Shams University...

Ngày tải lên: 10/08/2014, 10:21

11 338 0
Báo cáo y học: "Obstructive apneas induce early activation of mesenchymal stem cells and enhancement of endothelial wound healing" ppsx

Báo cáo y học: "Obstructive apneas induce early activation of mesenchymal stem cells and enhancement of endothelial wound healing" ppsx

... healing assays using rat MSC and primary rat endothelial cells (10 apneic and 10 control rats for each assay) Mesenchymal stem cells The study was performed on well-characterized Lewis rat marrow ... Clinical applications of blood-derived and marrow-derived stem cells for nonmalignant diseases JAMA 2008, 299:925-936 11 Ukai R, Honmou O, Harada K, Houkin A, Hamada H, Kocsis JD: Mesenchymal Stem Cells ... experimentation was carried out by AC and TS Data processing and statistical analysis was undertaken by AC, TS, and JMM AC, MR, TS, JMM, and DN participated in the discussion of the results and contributed...

Ngày tải lên: 12/08/2014, 11:22

7 282 0
Báo cáo y học: " Influence of hypoxia on the domiciliation of Mesenchymal Stem Cells after infusion into rats: possibilities of targeting pulmonary artery remodeling via cells therapies " doc

Báo cáo y học: " Influence of hypoxia on the domiciliation of Mesenchymal Stem Cells after infusion into rats: possibilities of targeting pulmonary artery remodeling via cells therapies " doc

... manufacturer's instructions It was analyzed by PCR for GFP transgene presence using a set of primer generating a 249 bp amplicon: forward, GCGACGTAAACGGCCACAAGTTC and reverse, CGTCCTTGAAGAAGATGGTGCGC ... Kunisato A, Tojo A, Okada S, Tokuhisa T, Hirai H, Makuuchi M, Hirata Y, Nagai R: Hematopoietic stem cells differentiate 10 11 12 into vascular cells that participate in the pathogenesis of atherosclerosis ... area of bone marrow (red arrow) A tibia harvested from a non-injected rat was used as control (C) MSC mesenchymal stem cells PCR polymerase chain reaction ROI regions of interest SDF-1 stromal...

Ngày tải lên: 12/08/2014, 18:20

13 251 0
Characterization of the secretion of mesenchymal stem cells and its relevance to cardioprotection

Characterization of the secretion of mesenchymal stem cells and its relevance to cardioprotection

... manufacturer's instruction The primers for OCT4 were 5′-AGTGAACAGGGAATGGGTGAA-3′ and 5′-AAG CGG CAG ATG GTC GT-3′, and for SOX2 were 5′-TGAGAGAAAGAAGAGGAGAGA-3′ and 5′-TGGGGGAAAAAAAGAGAGAGG-3′ ... Cardiac Inflammation Cardiac Transformation Cardiac Damage Heart Cardiac Necrosis/Cell Death Cardiac Hypertrophy Cardiac Dysfunction Cardiac Dilation Cardiac Hemorrhaging Renal Dilation Renal ... and Jayanthi Padmanabhan and Jeremy Lee (BTI) for the preparation and concentration of the conditioned medium Appendix A Supplementary data Supplementary data associated with this article can be...

Ngày tải lên: 10/09/2015, 08:42

161 343 0
Recruitment of mesenchymal stem cells to injury sites

Recruitment of mesenchymal stem cells to injury sites

... and the percentage of positive cells increased at passage and passage (Figure 3.2, Panel A) As it has been documented that FAP expression in chondrocytes was increased following a proinflammatory ... transplantation can also be used in treatment of cardiovascular diseases such as myocardial infarction and ischemia In two independent studies involving animal models, direct transplantation of ... β3, and β4 as well as other adhesion molecules such as ICAM-1, ICAM-3, VCAM-1 and ALCAM-1 (Kemp et al., 2005; Majumdar et al., 2003) Beta integrin in particular, was shown by Ruster et al to have...

Ngày tải lên: 13/10/2015, 15:54

111 231 0
w