addition of acid derivatives to the a position the claisen condensation
The addition of red lead to flat plate and tubular valve regulated miners cap lamp lead–acid batteries ppsx
... concentrations of red lead formed with the low rate formation procedure cured material already had a comparatively larger surface area The surface areas of the active material after the 11 capacity ... in temperature after the addition of the acid, most manufacturers add “chilled” acid to the batteries (about ◦ C) Due to the size of the MCL batteries and the amount of active material in this ... the availability of the electrolyte to the active material would be influenced by the respective porosity and available surface area of the active material The MCL battery is nominally rated at...
- 12
- 1,359
- 0
Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt
... indicates a dimer of approximately 48.5 kDa with a shoulder at approximately 100 kDa In all of these elutions, the same amount of hTK1 was applied (10 ng) and recovery of activities was approximately ... 1F, ADP was able to induce the tetramer, whereas, in the presence of AMP, the majority of the enzyme eluted as a dimer with a size of approximately 53 kDa A minor shoulder is seen at approximately ... have the same Vmax, meaning that the catalytic efficiency of ATP-incubated hTK1 is approximately 30-fold higher than that of non-incubated hTK1 The two TK1 forms can therefore be referred to as...
- 10
- 647
- 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... properties The kinetic parameters of the PA-catalysed hydrolysis of the studied phenylacetyl arylamides are compared in Table The substrates are arranged in a decreasing order of the ratio of their ... reasonable explanation of the PA activity with substrates like PhAc-pAB, PhAc-mAB, PhAc-oAB vs phenylacetyl 4-nitroanilide (PhAc-pNA), NIPAB and iso-NIPAB, but it suggests an explanation of the...
- 8
- 438
- 0
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot
... areas, respectively Structural organization of the ligand B Fig Binding of hexathymidine to amphipathic platforms of a BcCsp swapped dimer (A) Topological representation of a functional unit of ... between Arg56 and the O2 of the nucleobase However, after evaluating both crystal structures we conclude that the alternative orientation of the base and sugar–phosphate backbone of the nucleotide ... being transcribed, the affinity of the dA–U base pairs is insufficient to stabilize the DNA–RNA duplex, and the transcript, together with the RNA polymerase, disassembles from the template It is...
- 15
- 333
- 0
Application of serum proteomics to the Women’s Health Initiative conjugated equine estrogens trial reveals a multitude of effects relevant to clinical findings pot
... in the design of the study, statistical analysis, and data interpretation, and drafted the manuscript AA performed the statistical analysis VMF and SJP participated in the data acquisition and ... clinical trials, and that form the basis of further investigations Volume 1, Issue 4, Article 47 Katayama et al 47.14 Additional data files The following additional data are available with the online ... Cysteine alkylation with the light form of acrylamide was set as a fixed modification and with the heavy form of acrylamide (+3.01884) as a variable modification The database search results were then...
- 16
- 598
- 0
Pricing and Hedging of Credit Derivatives via the Innovations Approach to Nonlinear Filtering pptx
... fluctuations of credit spreads between defaults) and default contagion (the observation that at the default of a company the credit spreads of related companies often react drastically) A prime example ... represents the underlying pricing measure, and the information available to market participants is the market information FM As a consequence we assume that the current market value of the traded ... value of the process π On the other hand, the model parameters (the generator matrix of X and parameters of the functions a( ·) and λi (·), i = 1, , m) need to be estimated The latter task depends...
- 29
- 325
- 0
Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx
... Zucker fa ⁄ fa rat 1990 Results High activities of glucokinase and phosphorylase in hepatocytes from fa ⁄ fa rats Hepatocytes from fa ⁄ fa rats had a higher total activity of glucokinase (Fa ⁄ ? ... from fa ⁄ fa than Fa ⁄ ? rats and also that there is a rightward shift in the plots of glycogen synthesis against phosphorylase -a or glycogen synthase against phosphorylase -a in fa ⁄ fa compared ... However, the total activity of glycogen synthase and the activation state are the same as in control hepatocytes [6,11] In this study, we used three approaches to modulate the concentration and activity...
- 11
- 360
- 0
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
... AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT ... AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC ... AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA...
- 10
- 308
- 0
báo cáo hóa học:" The adequacy of policy responses to the treatment needs of South Africans living with HIV (1999-2008): a case study" doc
... Historically, the first attempts at valuing lives saved used the human capital approach In this approach, a human being is regarded as an asset with a capital value based (as is the case for any ... Comprehensive Plan: planned number of patients on ARVs and associated costs and total costs Year New cases starting ARVsa Total cases on ARVsa Total ARV diagnostic costs (ZAR million)b Total ARV drug ... Given that the costs of treating and also of not treating PLHIV with ARVs has been made and an estimate of the number of life years has also been made, then it is logical to attempt to value the...
- 11
- 439
- 0
Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx
... he has been there as an Assistant Professor of automata theory and programming language translation His main research topics are evolutionary computation applications and network optimization ... scenario: groundspeed, range, orientation of the trajectory with respect to the radar (radial and tangential projection of velocity heading), magnitude of the transversal acceleration, and magnitude ... process to adjust the filter parameters according to ARTAS specifications are presented and analyzed They have been obtained particularizing expression (6) to the case of a weight of for all magnitudes...
- 14
- 342
- 0
Báo cáo lâm nghiệp: "Contribution of different solutes to the cell osmotic pressure in tap and lateral roots of maritime pine seedlings: effects of a potassium deficiency and of an all-macronutrient deficienc" pptx
... depending on the part of the root considered By contrast to the post-apex of the tap root (TRPA) and to the apex of the lateral roots (LRA), the apex of the tap root (TRA) seemed to be protected: ... of a bunch of primary leaves), of the tap root (TR) and of the three longest lateral roots (LR; as an assessment of the length of the lateral roots) of each plant were measured just before harvest ... referred to as TR apex (TRA); b) the following 30 mm of the TR, referred to as TR post-apex (TRPA); c) the apical 10 mm of the LR, referred to as LR apex (LRA); and d) the remaining part of the LR,...
- 13
- 385
- 0
Báo cáo lâm nghiệp: "How the absolute growth rate of poplar adapts to the light-NO -dosage 3 G.A. Pieter" pot
... this paper, therea plant adapts its absolute growth rate to a linear nitrate dosage, as to PFR, through adaptation of the size The data fore, suggest that of the apex, casu quo of the vascular system ... that the absolute growth adapts in a way similar to that of nitrate dosage As the availability of (reduced) nitrate in the plant becomes limiting, the expansion of the vascular system stops and ... depended also mainly upon the P/N-quotient As expected, NR-act declined with the (relative) availability of nitrate and with (mean) age of the (increasing) group of older mature leaves The NR-act of...
- 7
- 251
- 0
báo cáo khoa học: "Use of RE-AIM to develop a multi-media facilitation tool for the patient-centered medical home" potx
... module stores patient action plans and provides ongoing access to the plans by the healthcare team and the patient for self-monitoring and follow-up Alternatively, the healthcare team may decide to ... and discuss practical implications and directions for future research and practice 6 RE-AIM planning and evaluation framework RE-AIM was developed to help health planners and evaluators to attend ... Estabrooks PA, Bradshaw M, Dzewaltowski DA, Smith-Ray RL Determining the impact of Walk Kansas: applying a team-building approach to community physical activity promotion Ann Behav Med 2008 August;36(1):1-12...
- 31
- 351
- 0
Báo cáo y học: "A rare case of intussusception leading to the diagnosis of acquired immune deficiency syndrome: a case report" pps
... a characteristic 'target mass' (arrows) in the right abdomen Contrast Contrast enhanced abdominal tomography at the level of the umbilicus showing a characteristic 'target mass' (arrows) in the ... abdominal radiograph showing dilated tissue of small Plain abdominal radiograph showing dilated loops of small bowel in the right hemiabdomen and a soft tissue mass revealed dilated loops of the small ... Greek man with a clean medical record and no history of abdominal operation presented to the emergency department with a 2-week history of gradually worsening abdominal pain Though the patient had...
- 4
- 235
- 0
Financial planning – the use of quantitative indicators to make a business decisions
... Discount factor is looked up in a table • £329.77 is what you would have to invest today at a rate of interest of 4.25% to earn £500 in 10 years time The discount factor can be found through valuation ... Rate of Return • A comparison of the profit generated by the investment with the cost of the investment Average annual return or annual profit • ARR = x 100 Initial cost of ... of equipment in a manufacturing plant, a whole new factory, etc • Used in both public and private sector http://www.bized.ac.uk Investment Appraisal • methods of investment appraisal: – Payback...
- 29
- 229
- 0
Introduction of An Introduction to the Philosophy of Mind
... metaphysics Some people believe that the age of metaphysics is past and that what metaphysicians aspire to achieve is an impossible dream They claim that it is an illusion to suppose that human ... physical states Then, in chapters and 4, I move on to discuss certain general theories of the nature of mental states and some attempts to explain how mental states can have content – that is, ... thinking that metaphysical claims are never justifiable, I not see why I should accept what they say about this Secondly, if they mean to abandon reasoned argument altogether, even in defence of their...
- 7
- 532
- 0
An analysis of errors related to the uses of english prepositions at, on, in produced by elementary level students at foreign languages & informatics center vinh city
... front, and top + of (different parts of a place) • Mrs Castle was waiting at the bottom of the stairs • They escaped by a window at the back of the house • I saw a taxi at the end of the street Pattern ... At church (attending church service) (prisoner) in the river / the lake / the sea / the at the seaside / at sea ocean at the top of the page / of + N 24 at the end of the road at the corner of ... had a hard day at the office (the office as a working place) • I left my coat behind in the office (the office is considered as a building) • There’s a good film at the cinema (the cinema as a...
- 67
- 705
- 3
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25