adding some number of days to a date

báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt

báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt

... visual impairment rates and indicators of other eye-care activities, such as number of visits/inhabitant, glaucoma diagnosis campaign, etc Inequality of quality of care could also be a factor ... the Paris area, whereas persons in Poitou-Charentes had a 2.10 lower chance than Parisians In contrast, an association was found between ophthalmologist density (number/ 100,000 inhabitants) and ... manuscript Acknowledgements The survey was supported by an unrestricted grant from Alcon Laboratories SA, Rueil-Malmaison, France, was conducted according to local laws, and was contracted to...

Ngày tải lên: 20/06/2014, 15:20

8 445 0
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127

Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127

... 106:1878 doi:10.1021/jp015532w 26 Hashimotoa H, Yokoyamab S, Asaokaa H, Kusanoc Y, Ikedad Y, Senoe M, Takadaa J, Fujiia T, Nakanishia M, Murakami R (2007) J Magn Magn Mater 310:2405 doi:10.1016/j.jmmm.2006.10.793 ... of the samples prepared in alcohol/water media with various volume ratios of alcohol to water: (a) 0:1, (b) 1:1, (c) 5:1 Fig TEM images of the samples prepared in alcohol/ water media with various ... show amorphous precipitate was obtained instead of a- FeOOH nanorods in alcohol/water media (5:1) without F127 Obviously, F127 plays an important role in the formation of a- FeOOH nanorods as a structuredirecting...

Ngày tải lên: 19/03/2014, 16:48

4 658 0
báo cáo hóa học:" Research Article Existence of Solutions to a Nonlocal Boundary Value Problem with Nonlinear Growth" pptx

báo cáo hóa học:" Research Article Existence of Solutions to a Nonlocal Boundary Value Problem with Nonlinear Growth" pptx

... them a problem at nonresonance Nonlocal boundary value problems were first considered by Bicadze and Samarski˘ ı and later by Il’pin and Moiseev 2, In a recent paper , Karakostas and Tsamatos ... References A V Bicadze and A A Samarski˘, Some elementary generalizations of linear elliptic boundary value ı problems,” Doklady Akademii Nauk SSSR, vol 185, pp 739–740, 1969 V A Il’pin and E I ... theory of Mawhin 12 Main Results We first recall some notation, and an abstract existence result Let Y , Z be real Banach spaces, let L : dom L ⊂ Y → Z be a linear operator which is Fredholm map of...

Ngày tải lên: 21/06/2014, 11:20

15 274 0
báo cáo hóa học:" Research Article Some Estimates of Integrals with a Composition Operator" potx

báo cáo hóa học:" Research Article Some Estimates of Integrals with a Composition Operator" potx

... York, NY, USA, 2009 S Morita, Geometry of Differential Forms, vol 201 of Translations of Mathematical Monographs, American Mathematical Society, Providence, RI, USA, 2001 H Cartan, Differential Forms, ... inequalities for operators,” Nonlinear Analysis: Theory, Methods & Applications, vol 71, no 12, pp e2350–e2357, 2009 S Ding and C A Nolder, “Ls μ -averaging domains,” Journal of Mathematical Analysis ... tensors,” Journal of Mathematical Analysis and Applications, vol 247, no 1, pp 236–245, 2000 11 C A Nolder, “Hardy-Littlewood theorems for A- harmonic tensors,” Illinois Journal of Mathematics, vol...

Ngày tải lên: 21/06/2014, 18:20

10 237 0
31 days to a better business in 2014

31 days to a better business in 2014

... caveats also to what Google refers to as “broad match” that don’t always accompany that advice One results The ads might be within a category 36 that matches a searcher’s query, but may not pages ... of work-related mail at the time, and attaching the envelopes to those letters was a good way to make sure that the return address was easily findable.) What small changes are you going to make ... now… As we learned in yesterday’s story from Bill, even small changes can lead to substantial rewards Take a chance Make a change It’s time DAY - Brian Patterson Google+ Communities to Get Active...

Ngày tải lên: 27/07/2014, 22:51

57 264 0
Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

... a substantially improved paper the electronic journal of combinatorics (2000), #R50 11 References [1] M Abramowitz and I .A Stegun, Eds., Handbook of Mathematical Functions with Formulas, Graphs ... Formulas, Graphs and Mathematical Tables, Dover Publications, New York, 1966 [2] E .A Bender, Central and Local Limit Theorems Applied to Asymptotic Enumeration, J Combinatorial Theory A 15 (1973), ... ≤ ln n and m is a fixed integer at least 2 Here, H2q are the Hermite polynomials defined before Theorem and the S2q are defined in Theorem In particular, we have a complete asymptotic expansion...

Ngày tải lên: 07/08/2014, 06:20

11 348 0
Báo cáo toán học: "On the Stanley-Wilf conjecture for the number of permutations avoiding a given pattern" ppt

Báo cáo toán học: "On the Stanley-Wilf conjecture for the number of permutations avoiding a given pattern" ppt

... Friedgut, E (1999) On the number of permutations avoiding a given pattern J Combinatorial Theory, Ser A, to appear [2] B´na, M (1997) Exact and asymptotic enumeration of permutations with subsequence ... The art of computer programming Addison-Wesley, Reading, MA [7] Regev, A (1981) Asymptotic values for degrees associated with strips of Young diagrams Adv Math 41, 115-136 [8] Simion, R., and ... Sn avoids σ and demonstrates that F (n, σ) ≥ for every n ≥ Fekete’s lemma [4], see also [9], is that if a1 , a2 , ∈ R satisfy for all m, n ≥ 1, am + an ≤ am+n , then limn→∞ an /n = inf n≥1 an...

Ngày tải lên: 07/08/2014, 06:22

4 238 0
Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx

Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx

... author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R Murty, Graph Theory with Applications ... [4] Chunhui Lai, Upper bound and lower bound of f (n), J Zhangzhou Teachers College(Natural Science Edition) 4(1)(1990) 29,30-34 [5] Chunhui Lai, On the size of graphs with all cycle having distinct ... Applications (Macmillan, New York, 1976) [2] Y Shi, On maximum cycle-distributed graphs, Discrete Math 71(1988) 57-71 [3] Chunhui Lai, On the Erd¨s problem, J Zhangzhou Teachers College(Natural Science...

Ngày tải lên: 07/08/2014, 06:22

6 477 0
Báo cáo toán học: "A note on the number of edges guaranteeing a C4 in Eulerian bipartite digraph" pot

Báo cáo toán học: "A note on the number of edges guaranteeing a C4 in Eulerian bipartite digraph" pot

... must have that every w ∈ A appears in at least one of A or A+ (it may appear in both; in particular, v ∗ appears in both A and A+ as there are no antiparallel edges) Hence, A ∪ A+ = A Thus, at ... an Eulerian bipartite digraph We may assume that G does not contain antiparallel edges, since otherwise G has a directed cycle of length and we are done the electronic journal of combinatorics ... of length at most A biregular bipartite digraph is an Eulerian bipartite digraph having the property that any two vertices in the same vertex class have the same indegree and outdegree The parameter...

Ngày tải lên: 07/08/2014, 06:23

6 283 0
Báo cáo toán học: "The Number of Positions Starting a Square in Binary Words" pps

Báo cáo toán học: "The Number of Positions Starting a Square in Binary Words" pps

... the search of strong words We refer to Lothaire [6] for elementary definitions in combinatorics on words Let A = {a, b, c} be a ternary alphabet, and B = {0, 1} a binary alphabet For a binary word ... Several parts of the proofs are computer aided, both for searching the strong words (the main concept in the proofs) as well as for checking their compatibilities We have included the Mathematica ... proves the claim ¯ ¯ ˆ Acknowledgement Tomi K¨rki acknowledges the support of Magnus Ehrnrooth Founa dation References [1] A S Fraenkel and J Simpson How many squares can a string contain? J Combin...

Ngày tải lên: 08/08/2014, 12:23

10 361 0
Báo cáo toán học: "On the number of subsequences with a given sum in a finite abelian grou" pptx

Báo cáo toán học: "On the number of subsequences with a given sum in a finite abelian grou" pptx

... Math 37 (2007), 1541– 1550 [12] W.D Gao, A Geroldinger and Q.H Wang, A quantitative aspect of non-unique factorizations: the Narkiewicz constants, International Journal of Number Theory, to appear ... and Analytic Theory, Pure and Applied Mathematics, vol 278, Chapman & Hall/CRC, 2006 [15] A Geroldinger, Additive group theory and non-unique factorizations, Combinatorial Number Theory and Additive ... Balandraud, An addition theorem and maximal zero-sum free set in Z/pZ, to appear [3] H.Q Cao and Z.W Sun, On the number of zero-sum subsequences, Discrete Math 307 (2007), 1687–1691 [4] H Davenport,...

Ngày tải lên: 08/08/2014, 14:23

10 360 0
Báo cáo y học: " Clinical evaluation of autoantibodies to a novel PM/Scl peptide antigen" doc

Báo cáo y học: " Clinical evaluation of autoantibodies to a novel PM/Scl peptide antigen" doc

... rheumatic diseases and to access all their clinical features Frank and colleagues analyzed sera from 216 patients with idiopathic inflammatory myopathies to assess putative associations between anti-SS -A/ Ro-52 ... anti-human IgG (Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA) was added to each well and incubated for an additional 30 The reactivity of the antigen-coated beads was determined on a ... scleroderma autoantibodies J Autoimmun 1999, 12:137-142 34 Yamanishi Y, Maeda H, Katayama S, Ishioka S, Yamakido M: Scleroderma-polymyositis overlap syndrome associated with antiKu antibody and rimmed...

Ngày tải lên: 09/08/2014, 06:22

10 487 0
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps

Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps

... used to amplify the N-terminal region of Vif The C-terminal portion of Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and ... using overlapping PCR to generate pHIV-YRHHY > A5 The forward primer VifF, 5'CAGGGAGATTCTAAAAG3', and the reverse primer YRHHYmutR, 5'CTTATTTTTGGATTAGTAC TTTCAGCGGCAGCTGCAGCAAACCAGTCCTTAGCTTTC C3', ... hypermutation across proviral DNA, cellular viral RNA (cRNA), and virion RNA (vRNA) observed in the vif of HIV-YRHHY > A5 (A and B) Schematic representation of a sample of proviral DNA sequences of...

Ngày tải lên: 13/08/2014, 05:21

15 320 0
Some Issues of E-pedagogy A Case Study at University of Education (VNU-UED)

Some Issues of E-pedagogy A Case Study at University of Education (VNU-UED)

... indices and evaluating the research model Results and analysis Table shows the average variance extracted (AVE) for each factor and indicates that the questions for each factor correlated with each ... to connect learners” or “reshaping and enhancing the traditional classroom more acceptable and effective” [2] 1.1 Aims and objectives The aim of this research was to establish argument of change ... applications should be easy to use and easy to learn, and in order to this, developers have to take into consideration the psychological, ergonomic, social and organizational factors that determine how...

Ngày tải lên: 13/08/2015, 10:09

12 340 0
30 days to a better IELTS writing

30 days to a better IELTS writing

... meteorologists have to make use of satellite photo images Also they are making observations over radar screen and synoptic chart As soon as any changes are reflected on those photos, screen and charts changes ... population and there is also main roads and raiway linking the site to Cransdon and Bransdon wich are 25 km and 16 km faraway respectively The advantage of this location is that it target almost ... and the structure can be clearly seen Ideas are logically arranged There are a number of transition words but add a transition word at the beginning of your concluding paragraph to signal that...

Ngày tải lên: 07/03/2016, 10:30

241 666 3
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

... the American society, there are many races such as white, black or African-American, American Indian or Alaska native, Asian, native Hawaiian, other Pacific Islander and ethnic groups due to immigrations ... doctorate and was working part-time at a bookstore; Sang’s boyfriend, Farouk, an Egyptian American who was teaching Middle Eastern history at Harvard; Heather, the housemate of Sang and Paul, ... jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another galaxy.” (p.1090) By then, all the advantages...

Ngày tải lên: 07/11/2012, 15:01

49 785 1
Tài liệu Adding value to traditional products of regional origin - A guide to creating a quality consortium pptx

Tài liệu Adding value to traditional products of regional origin - A guide to creating a quality consortium pptx

... whose aim is to add value to a traditional product of regional origin and act as a platform for the fair and balanced coordination of interests and efforts in the same value chain The reach of the ... the fact that any individual company can protect a traditional product of regional origin by obtaining a conventional trademark, there are also other categories of marks that are of particular ... part of a broad initiative whose ultimate aim was to register Kintamani Bali Arabika coffee as a geographical indication, organic certification was obtained first (Gerz in: Gerz et al 2008) 30 a...

Ngày tải lên: 18/02/2014, 21:20

79 438 0
Cách sử dụng (Something) is down to (a number of something) pdf

Cách sử dụng (Something) is down to (a number of something) pdf

... to half a bag of rice” = “chúng n a bao gạo” Thông thường bạn nói số lượng vật/ đồ vật bị giảm, bạn liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tôi, Claire Maria Lưu ý sử ... bạn bị sa thải Và có bạn, sếp bạn nhân viên Bạn nói chuyện với bạn tình “We’re down to only people now” (something) is down to (a number of something) Khi có nhiều từng, bạn dùng cụm “down to ” ... thao “They’re down to teams now” = “giờ có đội” Hoặc nói việc bạn không sở hữu đồ vật mình: We sold the van, so we’re down to two vehicles now - bán xe tải, xe Hoặc đồ ăn: “We’re down to half a...

Ngày tải lên: 10/03/2014, 11:20

6 702 2
w