adding a number of months to a date

Ngày tải lên: 09/08/2014, 01:21

... to half a bag of rice” = “chúng n a bao gạo” Thông thường bạn nói số lượng vật/ đồ vật bị giảm, bạn liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tôi, Claire Maria Lưu ý sử ... thao “They’re down to teams now” = “giờ có đội” Hoặc nói việc bạn không sở hữu đồ vật mình: We sold the van, so we’re down to two vehicles now - bán xe tải, xe Hoặc đồ ăn: “We’re down to half a ... bạn bị sa thải Và có bạn, sếp bạn nhân viên Bạn nói chuyện với bạn tình “We’re down to only people now” (something) is down to (a number of something) Khi có nhiều từng, bạn dùng cụm “down to ”...

Ngày tải lên: 10/03/2014, 11:20

... MONTH YEAR Family name Family name Given names Given names DAY MONTH YEAR DAY Date of birth MONTH YEAR Date of birth Sex Male Sex Female Male Relationship to main applicant Place of birth Relationship ... DAY MONTH YEAR Date of birth Sex Male Female Relationship to main applicant Place of birth Country(ies) of citizenship Passport number Country of passport DAY MONTH YEAR DAY MONTH YEAR Date of ... MONTH YEAR DAY Date of issue MONTH YEAR Date of issue DAY MONTH YEAR Date of expiry Date of expiry Issuing authority/ Place of issue as shown in passport Issuing authority/ Place of issue as shown...

Ngày tải lên: 15/03/2014, 20:20

... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi...

Ngày tải lên: 18/06/2014, 22:20

... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi...

Ngày tải lên: 20/06/2014, 04:20

... visual impairment rates and indicators of other eye-care activities, such as number of visits/inhabitant, glaucoma diagnosis campaign, etc Inequality of quality of care could also be a factor ... grant from Alcon Laboratories SA, Rueil-Malmaison, France, was conducted according to local laws, and was contracted to Cemka, Bourg-la-Reine, France Alcon France SA employed Gilles Berdeaux References ... the Paris area, whereas persons in Poitou-Charentes had a 2.10 lower chance than Parisians In contrast, an association was found between ophthalmologist density (number/ 100,000 inhabitants) and...

Ngày tải lên: 20/06/2014, 15:20

... Complex and Adaptive Laboratory, involved in artificial intelligence applications His main interests are radar data processing, navigation, and air traffic management, with special stress on data fusion ... transversal maneuver, and a second transition to come back to uniform motion When the target is far enough from the radar, a pure radial approach to the radar leads to the worst case for transversal ... conditions are classified with respect to radar and aircraft characteristics because of the very different behavior of any tracker for varying input conditions Radar parameters represent the accuracy and...

Ngày tải lên: 23/06/2014, 00:20

Ngày tải lên: 06/08/2014, 18:20

... The association of trauma death and alcohol use in a rural state J Trauma 1992, 33:737-742 Klatsky AL, Armstrong MA: Alcohol use, other traits, and risk of unnatural death: a prospective study Alcohol ... number of legal and illegal psychotropic substances abused in addition to alcohol was related to unnatural types of death There was a trend towards a higher risk for unnatural death for every additional ... Brugal MT, Domingo-Salvany A, Puig R, Barrio G, Garcia de Olalla P, de la Fuente L: Evaluating the impact of methadone maintenance programmes on mortality due to overdose and aids in a cohort of...

Ngày tải lên: 11/08/2014, 17:20

... Asmussen K, Lauritsen B, Vinterberg H, Kreiner S, Jordan A: Low Back Pain Rating scale: validation of a tool for assessment of low back pain Pain 1994, 57:317-326 The Danish National Board of Health: ... R, Carrino JA, Deyo RA: Imaging strategies for low-back pain: systematic review and meta-analysis Lancet 2009, 373:463-472 Jarvik JG, Deyo RA: Diagnostic evaluation of low back pain with emphasis ... similar in relation to age, sex, severity of back pain and leg pain, and functional disability (Table 1) The median age for both groups was 48 years and there was almost an even distribution of...

Ngày tải lên: 13/08/2014, 14:20

... but may arguably lead to an underestimation of the burden of mental disorders in Canada's adult population [43] and as a consequence, to an underestimate of the number of children exposed to parental ... exposed to parental MI in Canada are not available, the aim of this paper is to use data from the Canadian Community Health Survey cycle 1.2 – Mental Health and Well-Being (CCHS 1.2) to estimate ... 16:35-39 Handley C, Farrell GA, Josephs A, Hanke A, Hazelton M: The Tasmanian children's project: the needs of children with a parent/carer with a mental illness Australian and New Zealand Journal of...

Ngày tải lên: 13/08/2014, 18:21

... of the number of mastitis cases in dairy cattle 382 H Naya et al From previous exploratory analysis [16,24], the age of animals appears to be a main source of variability of the number of spots, ... expensive and cumbersome to record such a value for each animal on a routine basis Laboratory techniques are labour intensive and slow In this context, the number of dark spots in the fleece area of animals ... development of pigmented fibres, an experiment was carried out in which fleeces of animals from two experimental flocks were sampled yearly at shearing for laboratory analysis Each animal was inspected, and...

Ngày tải lên: 14/08/2014, 13:22

... of rain, roaring of rivers across the plain • Richard gave Robin a rap in the ribs for roasting his rabbit so rare • Strawberries, raspberries and redcurrants with real cream are really refreshing ... Dutch too much • The child watched his teacher and fetched him the chalk • Charles and Richard chewed cheese and chewed gum • Charles is a cheerful chicken-farmer He chuckles at the chance Of a choice ... jackets are watching the jaguar in the cage • It was a joy for Jack and George, the German boys, to cross the large bridge before entering the village Tongue twisters - The letter „r“ • Reading...

Ngày tải lên: 17/03/2015, 10:05

... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to- 895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part of the ... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic...

Ngày tải lên: 26/10/2012, 10:04

... : Japanese levels of proficiency or experience LAN : Local Area Network NASDAQ : National Association of Securities Dealers Automated Quotation System NASSCOM : National Association of Software ... application of engineering to software, and (2) the study of approaches to application (IEEE, 1993) A software process determines activities and organizational procedures to enhance collaboration ... publishing, and graphics, multimedia According to Krishnan (1998) the software industry can be broadly classified as custom software, software service and packaged software Custom software includes...

Ngày tải lên: 27/10/2012, 16:41

... the American society, there are many races such as white, black or African-American, American Indian or Alaska native, Asian, native Hawaiian, other Pacific Islander and ethnic groups due to immigrations ... doctorate and was working part-time at a bookstore; Sang’s boyfriend, Farouk, an Egyptian American who was teaching Middle Eastern history at Harvard; Heather, the housemate of Sang and Paul, ... of literary works As David Stuart Davies has appealed, writers in general and story tellers in particular are the “magicians who can take the raw material of life, enhance it and mould it into...

Ngày tải lên: 07/11/2012, 15:01

... differently to ads replaying the September 11 attacks; the amygdalas of Democrats lit up far more noticeably than the amygdalas of Republicans Marco Iacobini, the lead researcher and an associate professor ... Mumbai The next day São Paolo Or Dublin, Tokyo, Edinburgh, San Francisco, Athens, Lima, Sri Lanka, or Shanghai But my hectic travel schedule is an advantage I can bring to a team that’s usually too ... was about to take a seat at the neuroscience table and in the process, take on a brainy new look * * * IN 1975, WATERGATE was still scandalizing America Margaret Thatcher was elected the leader...

Ngày tải lên: 17/10/2013, 18:20

... non-verbal aspects, paralinguistic and extralinguistic factors master cross-cultural pragmatics as a whole A teacher may select any activity applicable to his/her classroom (See Appendix) To conclude, ... Goffman’s views on face and face-work, Brown & action threaten their negative face, whereas acts that appear as Levinson [6] offer a descriptive analysis of the strategies used by disapproving of ... Face-Threatening Acts 2.2.1.1 The Notion of Face (FTAs) FTAs, which may be targeted at either positive or negative Based on his observational research, Goffman [10] claims that face wants, will tend to...

Ngày tải lên: 26/11/2013, 13:21

... appearance before going to stage As an overall trend, we can see that all of students at Vinh University have a good preparation of appearance before being a public speaker As can be seen clearly ... understand and know the way to improve their appearance when being a public speaker It will have a good effect to their speech later Through this part, we can realize that attitude and appearance are ... recommended to have a pair of interpreters to alternate every 15-30 minutes Simultaneous interpretation is usually ideal for events with a large number of participants broadcasting in different languages,...

Ngày tải lên: 25/12/2013, 20:21

... tools Each tool belongs to a particular game and it cannot be used with any other game For instance, a deck of playing cards can not be used to play in the Story Telling game Besides, some games ... define what games are Wittgenstein concluded that people apply the term game to a range of disparate human activities that bear to one another only what one might call family resemblances French ... presentation of an utterance in a source language” ( p.11) In professional parlance, interpreting can be understood as “the facilitating of communication from one language form into its equivalent,...

Ngày tải lên: 25/12/2013, 20:21