addictive and is there a safe level of consumption

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG GCCGGGATCCTAGGGCGAATTGGGTACC Ó FEBS 2004 Analysis of the N-myristoylation ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC ... AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

... low ADH(Vmax) and high Gra3PDH(Vmax) and is similar to a sub regime of extreme JðglycolysisÞ PFK flux control in which CADH approaches 0.2, in that it is correlated with reduced ADH(Vmax) and that ... of metabolite concentration and flux are obtained from populations of yeast cells and so reflect an aggregate of the states of many individual organisms Although no fitted model in this paper individually ... represent natural variability in the yeast population, and we investigated the regions of parameter and variable space described by them Metabolic Fig Schematic of the model yeast glycolytic pathway...

Ngày tải lên: 17/03/2014, 11:20

11 530 0
gorban a.n. singularities of transition processes in dynamical systems.. qualitative theory of critical delays (ejde monograph 05, 2004)(55s)

gorban a.n. singularities of transition processes in dynamical systems.. qualitative theory of critical delays (ejde monograph 05, 2004)(55s)

... points of the axis are non-wandering; is the place of delay near fixed points Lemma 3.5 A closed invariant set W is Lyapunov stable if and only if it has a fundamental system of positively invariant ... mechanisms of slow relaxations can be readily mentioned: The delay of motion near an unstable fixed point, and the delay of motion in a domain where a fixed point appears under a small change of parameters ... there are both τ1 -slow relaxations and Ω(x)-bifurcations For A- flows a weaker version of the statement of Theorem 3.12 is valid (A- flow is called a flow satisfying S.Smale A- axiom [68], in regard...

Ngày tải lên: 24/04/2014, 16:50

55 252 0
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt

Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt

... transplantation and 2) analyzed long term engraftment in multiple organs and the infarct zone as well as the regenerative effects of cell treatment by molecular and mechanistic approaches at ... evaluated on the day of transplantation (day post surgery) and at one and four weeks post transplantation as described [20] Animals were stratified into groups with small, medium and large infarcts, ... ALDHloLin- transplanted animals and never in multiple organs of the same animal (data not shown) Engrafting human cells appeared small and round to oval shaped with a small cytoplasm relative to the...

Ngày tải lên: 18/06/2014, 16:20

13 506 0
báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf

báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf

... inhibition of VCAM-1 expression in cerebral vasculature by anandamide provides a new mechanism that may explain the therapeutic action of increased anandamide tone in neuroinflammatory diseases like ... clinical form of the disease [8] The endocannabinoid system (ECS), consists of endogenous ligands (AEA and 2-AG) and congeners, target receptors, synthesis (NAPE-PLD; DAG lipase), and degradation ... A, Bari M, Granata F, Gasperi V, De Stefano ME, FinazziAgrò A, Strom R: Regulation by cannabinoid receptors of anandamide transport across the blood-brain barrier and through other endothelial...

Ngày tải lên: 19/06/2014, 22:20

13 466 0
báo cáo hóa học: " Modulation of spinal cord synaptic activity by tumor necrosis factor alpha in a model of peripheral neuropathy" potx

báo cáo hóa học: " Modulation of spinal cord synaptic activity by tumor necrosis factor alpha in a model of peripheral neuropathy" potx

... intrathecal application of exogenous TNFα induced mechanical allodynia and thermal hyperalgesia in rats and mice [13-15] Pain hypersensitivity associated with peripheral neuropathy was attenuated ... Modulation of spinal cord synaptic activity by tumor necrosis factor α in a model of peripheral neuropathy Diana Spicarova, Vladimir Nerandzic and Jiri Palecek Department of Functional Morphology, ... Committee and were consistent with the guidelines of the International Association for the Study of Pain, the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the...

Ngày tải lên: 19/06/2014, 22:20

23 381 0
Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx

Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx

... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... The AgNOR analysis was performed by counting the number of AgNOR (black dots) per cell at a magnification of 1000× (each group n = animals) Analysis of data The secretory basal and stimulated activity ... activity of glandular cells Therefore, an AgNOR-analysis was performed which is related to rRNA transcriptional activity and cellular pro- Page of 10 (page number not for citation purposes) Journal of...

Ngày tải lên: 20/06/2014, 00:20

10 568 0
Báo cáo lâm nghiệp: "Genetic variation of wood density components in a radiata pine progeny test located in the south of Chile" pps

Báo cáo lâm nghiệp: "Genetic variation of wood density components in a radiata pine progeny test located in the south of Chile" pps

... the scale differences among traits and allowed reliable comparisons of family covariances among different traits Covariance components, for each cambial age and transformed (standardized) traits, ... Cov(Ax, Ay) and CovFxy are the additive genetic covariance and family covariance component between traits X and Y, respectively Approximate standard errors of heritability and new family covariance ... The family covariance between ED and EA was negative at age and positive between ages and 7, which is mainly juvenile wood (Fig 6B) This covariance decreased with cambial age after ring and was...

Ngày tải lên: 08/08/2014, 00:21

10 341 0
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx

Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx

... stay from day to weeks and serve regional agencies of the Massachusetts Department of Mental Health They have the same mission and similar staffing, for both psychosocial and pharmacological ... beginning of treatment (that is, from the subject's examination by a psychiatrist and formulation of a treatment plan by the clinical team) Research assistants ('raters'), who were master's level ... Health Organization: International Statistical Classification of Diseases and Related Health Problems: 10th Revision (ICD-10) Volume Geneva, Switzerland: World Health Organization; 2007 20 Laddis...

Ngày tải lên: 08/08/2014, 23:21

12 478 0
Báo cáo y học: "Systematic mapping of two component response regulators to gene targets in a model sulfate reducing bacterium" ppt

Báo cáo y học: "Systematic mapping of two component response regulators to gene targets in a model sulfate reducing bacterium" ppt

... analysis PLoS Biol 2005, 3:e334 10 Kobayashi K, Ogura M, Yamaguchi H, Yoshida K, Ogasawara N, Tanaka T, Fujita Y: Comprehensive DNA microarray analysis of Bacillus subtilis twocomponent regulatory ... Berriman M, Tivey A, Patel C, Bohme U, Barrell BG, Parkhill J, Rajandream MA: Artemis and ACT: viewing, annotating and comparing sequences stored in a relational database Bioinformatics 2008, 24:2672-2676 ... DVU0110, and DVUA0057 (each colored differently) have overlapping targets Objects are not drawn to scale This is a conservative list of the most likely targets, and the complete list of peaks is available...

Ngày tải lên: 09/08/2014, 23:20

61 401 0
Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt

Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt

... and drafted the manuscript FG and HK participated in the data analysis and review of the manuscript YN performed project planning, participated in the data analysis and helped to draft the manuscript ... biological role and function of HSV-2 UL56, and its interaction with E3 ligase Nedd4, we visualized and characterized the dynamic intracellular localization of UL56 and Nedd4 using live-cell imaging ... γ-adaptin and δ-adaptin), and partially with marker proteins for Golgi complex proteins (Golgi58K and GM130) and early endosomes (EEA1) Scale bars, 10 μm Page of 13 (page number not for citation...

Ngày tải lên: 12/08/2014, 04:20

13 290 0
Báo cáo y học: "Association between inflammatory mediators and response to inhaled nitric oxide in a model of endotoxin-induced lung injury" docx

Báo cáo y học: "Association between inflammatory mediators and response to inhaled nitric oxide in a model of endotoxin-induced lung injury" docx

... infusion, and after 15 minutes of nitric oxide inhalation Data represent the mean ± standard deviation CO, cardiac output; MPAP, mean pulmonary arterial pressure; PVR, pulmonary vascular resistance; ... pulmonary vascular resistance, whereas the cardiac output remained unaltered There was a mean decrease in the mean arterial pressure The systemic vascular resistance fell as well, but the decrease ... elucidate the mechanisms of response and nonresponse to INO in an endotoxin-induced animal lung injury model Materials and methods Animals After approval of the local Animal Research Ethical committee,...

Ngày tải lên: 13/08/2014, 11:23

8 363 0
Báo cáo y học: "Factors associated with internalizing or somatic symptoms in a cross-sectional study of school children in grades 1-10" potx

Báo cáo y học: "Factors associated with internalizing or somatic symptoms in a cross-sectional study of school children in grades 1-10" potx

... recurrent abdominal pain and anxiety disorders J Pediatr Psychol 2009, 34:176-186 Kristjansdottir G: Prevalence of pain combinations and overall pain: A study of headache, stomach pain and back pain among ... questionnaire, developed by Audhild Løhre ache and headache as dependent variables First, each factor was included separately as a covariate, adjusting only for gender and grade Thereafter, all covariates ... for sadness, anxiety, stomach ache and headache The left part of Table 2, 3, 4, and show the association of each independent variable, with adjustment for gender and grade In the right part of...

Ngày tải lên: 13/08/2014, 18:21

9 309 0
Báo cáo y học: "Hypervolemia induces and potentiates lung damage after recruitment maneuver in a model of sepsis-induced acute lung injury" pps

Báo cáo y học: "Hypervolemia induces and potentiates lung damage after recruitment maneuver in a model of sepsis-induced acute lung injury" pps

... to animal preparation, performance of experimental work, analysis of mechanical and histological data, statistical analysis, and writing of the manuscript FFC contributed to animal preparation, ... GTC CTG AA-3' and antisense 5'-CTT CAG AGG CAG GAA ACA GG-3'); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; sense 5'-GGT GAA GGT CGG TGTG AAC- 3' and antisense 5'-CGT TGA TGG CAA CAA TGT ... [9,21] All data were analyzed using ANADAT data analysis software (RHT-InfoData, Inc., Montreal, Quebec, Canada) Echocardiography Volemic status and cardiac function were assessed by an echocardiograph...

Ngày tải lên: 13/08/2014, 20:22

16 287 0
Báo cáo sinh học: "Marginal inferences about variance components in a mixed linear model using Gibbs sampling" ppsx

Báo cáo sinh học: "Marginal inferences about variance components in a mixed linear model using Gibbs sampling" ppsx

... (1990) and Gelfand and Smith variable x can be written as: An estimator of p(!) is: (1990), the marginal density of a random Thus, the estimator of the marginal density of Qis: e The estimated values ... transformations of random variables to the estimated densities, with minimal additional calculations Examples of estimating the densities of variance ratios and of an intraclass correlation are ... belief&dquo; parameter, and se ) can be interpreted as a u; e (v ) a (su prior value of the appropriate variance In this paper, as in Gelfand et al (1990) we assume the degree of belief parameters, v and...

Ngày tải lên: 14/08/2014, 20:20

22 249 0
a study on theory of iceberg in  the old man and the sea  by earnest hemingway = nghiên cứu về nguyên lý tảng băng trôi trong tác phẩm  ông già và biển cả  của ernerst hemingway

a study on theory of iceberg in the old man and the sea by earnest hemingway = nghiên cứu về nguyên lý tảng băng trôi trong tác phẩm ông già và biển cả của ernerst hemingway

... and Halliday and Hasan, 1973, 1978, 1989, 1994) had drawn certain attention to this branch by clarifying some “contextual, grammar and cohesional models as well as pragmatic and conversational ... that postulated a double audience, consisting of one party that hearing shall hear and shall not understand, and another party that, 11 when more is meant than meets the ear, is aware both of ... far from the capital city of Havana Havana is the capital of Cuba and forms a distant background to Santiago‘s journey; he uses 14 the lights of the city to find his way back home at night A...

Ngày tải lên: 02/03/2015, 14:25

49 1,8K 7
On the conformation of DNA confined in a nanochannel or absorbed at an interface

On the conformation of DNA confined in a nanochannel or absorbed at an interface

... conformation of DNA, a range of materials are used These materials include mica and polydimethylsiloxane (PDMS) PDMS is widely used in micro- and nanofluidics in the area of lab-on-chip applications ... the physical and chemical phenomena that are important in the condensation of DNA In this thesis, we seek to uncover the behavior of single stranded and double stranded DNA molecules, and explore ... PDMS- and mica-involved experimental strategies allow the investigation of the conformations and real-time responses of DNA 2.1.1.General Features of Mica Mica is a non-swelling clay mineral It has...

Ngày tải lên: 14/09/2015, 14:01

153 465 0
Tài liệu USB in a Nutshell - Making Sense of the USB Standard ppt

Tài liệu USB in a Nutshell - Making Sense of the USB Standard ppt

... 1111 DATA0 DATA1 DATA2 MDATA Handshake 0010 1010 1110 0110 ACK Handshake NAK Handshake STALL Handshake NYET (No Response Yet) Special 1100 1100 1000 0100 PREamble ERR Split Ping There is bits ... of transaction to follow, data packets contain the payload, handshake packets are used for acknowledging data or reporting errors and start of frame packets indicate the start of a new frame Token ... Data0 Data1 Data packets have the following format Sync PID Data CRC16 EOP Handshake Packets There are three type of handshake packets which consist simply of the PID ACK – Acknowledgment that...

Ngày tải lên: 13/12/2013, 00:15

30 745 0
w