add a method to a type without modifying it
Báo cáo khoa học: "HOW TO DETECT GRAMMATICAL ERRORS IN A TEXT WITHOUT PARSING IT" doc
Ngày tải lên :
24/03/2014, 05:21
... chosen grammatical tag; this likelihood is normalised relative to a threshold, so that values greater than one constitute "acceptable" grammatical analyses, whereas values less than one am indicative ... dictionary with error-tags for all words Adding error tags to a large lexicon is a non-trivial research task; and adding error-tags to the analysis stage increases computation, since there are more ... relevant factors including: i) the degree of similarity to the word actually typed (this measure would be available anyway, as it has to be calculated during cohort generation; the actual word typed...
- 8
- 470
- 0
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps
Ngày tải lên :
09/08/2014, 10:21
... adjuvant arthritic rats Clin Exp Rheumatol 1999, 17:553-560 40 Segawa Y, Yamaura M, Aota S, Omata T, Tuzuike N, Itokazu Y, Oka H, Tamaki H, Nakamura T: Methotrexate maintains bone mass by preventing ... Murihead KA, Hanna N: Methotrexate inhibits macrophage activation as well as vascular and cellular inflammatory events in rat adjuvant induced arthritis J Rheumatol 1988, 15:745-749 47 Davis P, ... the inflammation as seen from the macroscopic studies of the arthritic paws, but also modulates the mechanical hyperalgesia in treated arthritic rats In addition, the method of gait analysis showed...
- 7
- 569
- 0
Development of a method to measure consumer emotions associated with foods
Ngày tải lên :
03/04/2013, 21:07
... asymmetry”, and attribute it to two things: the general ‘‘positive affective disposition towards eating and tasting food” and the fact that actual food products ‘‘are designed to appeal to consumers.” ... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate,...
- 10
- 781
- 3
Báo cáo khoa học: "Structural Semantic Relatedness: A Knowledge-Based Method to Named Entity Disambiguation" potx
Ngày tải lên :
16/03/2014, 23:20
... identify it as a WordNet concept, and use its primary word sense as its semantic meaning; to find whether a N-gram is a named entity, we match it to the named entity list extracted using the openCalais ... semantic meaning explanation, e.g., the “MVP” has three semantic meaning, as “most valuable player, MVP” in WordNet, as the “Most Valuable Player” in Wikipedia and as a named entity of Award type) ... openCalais API3, which contains more than 30 types of named entities, such as Person, Organization and Award; to find whether a N-gram is a Wikipedia concept, we match it to the Wikipedia anchor...
- 10
- 284
- 0
10 Ways to Make Money Without a Job
Ngày tải lên :
18/03/2014, 10:33
... Share This Infographic Related Posts 10/22/2010 • Who Are Entrepreneurs? [infographic] ...
- 3
- 479
- 1
a simple method to synthesize nanowires titanium dioxide from layered titanate particles
Ngày tải lên :
19/03/2014, 16:47
... transferred into a 30 ml autoclave, and kept at 140–170 °C for 3–7 days The as-product was filtered, washed with H2O, and finally dried at 60 °C for h 2.2 Characterization of samples X-ray powder diffraction ... Na2CO3 (Wako) and TiO2 (ST-01, Ishihara Sangyo Kaisha LTD.) in the stoichiometrical ratio 1:3 The powders were mixed together and repeatedly ground in an agate mortar, and calcined at 1000 °C ... Results and discussion Fig shows SEM images of the raw material Na2Ti3O7 and the sample obtained at 170 °C for days It is very different between the raw material Na2Ti3O7 and the sample Only particles...
- 4
- 325
- 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot
Ngày tải lên :
18/06/2014, 15:20
... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... installation of the hypobaric chamber and annexed facilities We are also grateful to Mr Juan A Silva from Universidad de Antofagasta (Chile) by his collaboration in some data collection, and to ... manuscript writing; CA: collection and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved...
- 6
- 426
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
Ngày tải lên :
18/06/2014, 16:20
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al ... 3’) SEA SED M18970 M28521 cttgtacatatgagcgagaaaagcgaagaa cgttctcgagaatgaaaacattgattc gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata ... gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat...
- 9
- 568
- 0
báo cáo hóa học: " Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pptx
Ngày tải lên :
18/06/2014, 19:20
... severity of the illness itself, but rather by the perceived threat it poses to the intactness of the self, i.e the impact and meaning a disease has for a patient In addition, personality factors are ... measure and contributed to the manuscript MdeW contributed to the quality of data management and the manuscript NZ coordinated the assessments in the diabetes outpatient clinic and data management ... study was to evaluate the validity of the PRIMS-RII as a measure of suffering in people with diabetes Although the concept of suffering is abstract, the vast majority of patients was able to complete...
- 7
- 410
- 0
Báo cáo hóa học: " A broadly applicable method to characterize large DNA viruses and adenoviruses based on the DNA polymerase gene" doc
Ngày tải lên :
20/06/2014, 01:20
... of Ito and Braitwaite [1] and overlap regions designated as regions and by Villarreal et al [4] VanDevanter et al [5] used degenerate primers to the DNA polymerase gene of mammalian and avian ... forward and reverse sequencing primers, a lower strand primerACGATTTSAGTGCCTTCGTAGATG and a upper strand primer-CATCTACGAAGGCACTSAAATCGT Data were assembled using MacDNASIS and sequences were edited ... sequenced As this target fragment of more species of DNA viruses are sequenced, BLAST and GenBank will prove to be a utilitarian software and database for virus diagnostic work that is readily available...
- 10
- 463
- 0
báo cáo hóa học:" Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pdf
Ngày tải lên :
20/06/2014, 16:20
... severity of the illness itself, but rather by the perceived threat it poses to the intactness of the self, i.e the impact and meaning a disease has for a patient In addition, personality factors are ... measure and contributed to the manuscript MdeW contributed to the quality of data management and the manuscript NZ coordinated the assessments in the diabetes outpatient clinic and data management ... study was to evaluate the validity of the PRIMS-RII as a measure of suffering in people with diabetes Although the concept of suffering is abstract, the vast majority of patients was able to complete...
- 7
- 395
- 0
báo cáo hóa học: " F-fluoride PET: changes in uptake as a method to assess response in bone metastases from castrate-resistant prostate cancer patients treated with 223Ra-chloride (Alpharadin)" pdf
Ngày tải lên :
21/06/2014, 02:20
... K, Nakajima H, Miyazaki T, Yayama T, Kawahara H, Kobayashi S, Tsuchida T, Okazawa H, Fujibayashi Y, Baba H: Effects of Alendronate on bone metabolism in glucocorticoid-induced osteoporosis measured ... UK 2Academic Urology Unit, Royal Marsden Hospital and Institute of Cancer Research, Sutton, UK 3Algeta ASA, Oslo, Norway Authors’ contributions GC study design, data acquisition, analysis, manuscript ... study was to demonstrate the early treatment response to radium-223 ( 223 Ra)-chloride Page of (Alpharadin, Algeta ASA, Oslo, Norway), a bone-seeking alpha emitter with a half-life of 11.4 days,...
- 6
- 286
- 0
Báo cáo hóa học: " A Novel Method to Fabricate Silicon Nanowire p–n Junctions by a Combination of Ion Implantation and in-situ Doping" docx
Ngày tải lên :
22/06/2014, 00:20
... and increase the density of the NWs Afterward, a 1–2-nm thick Au film was deposited in-situ at the same temperature The Au film subsequently broke into Au droplets to serve as the NW growth initiator ... NWs a An as-grown p–i NW b scanning electron microscope (SEM) image of an as-grown p–i NW c A NW with the Au cap removed d SEM image of a NW with the Au cap removed e P ion implantation on a NW ... mechanism is dominating A value close to for the ideality factor indicates that recombination across the p–n junction through the surface states is dominant in the carrier transport mechanism...
- 4
- 332
- 0
Báo cáo hóa học: "A Simple Method to Synthesize Cadmium Hydroxide Nanobelts" pptx
Ngày tải lên :
22/06/2014, 01:20
... sealed, warmed up at a speed of 8C/min and maintained at 100 8C for h, and was then cooled to room temperature on standing The white precipitate was filtered off, washed with absolute ethanol and distilled ... distilled water for several times, and then dried in vacuum at 40 8C for h X-ray diffraction (XRD) patterns were carried out on a Japan Rigaku D/max rA X-ray diffractometer equipped with graphitemonochromatized ... graphitemonochromatized high-intensity Cu Ka radi˚ ation (k = 1.541784 A) The accelerating voltage was set at 50 kV, with 100 mA flux at a scanning rate of 0.06°/s in the 2h range 10–80° The X-ray photoelectron...
- 5
- 371
- 0
Báo cáo hóa học: " Research Article A New Method to Represent Speech Signals Via Predefined Signature and Envelope Sequences" pptx
Ngày tải lên :
22/06/2014, 23:20
... (B S Atal and N S Jayant), Cambridge University Press, Cambridge, UK, 1998 [4] A M Karas and B S Yarman, A new approach for repre¸ senting discrete signal waveforms via private signature base ... regard, computational lag may be disregarded by an appropriate buffering operation As far as digital communication systems are concerned, SYMPES may be considered as a coding scheme In this case, ... the IPA Handbook and sampled with KHz sampling rate were utilized to generate PSS and PES with LF = 16 samples In the generation process, all the available characteristic sentences (total of...
- 17
- 318
- 0
Báo cáo toán học: "A New Method to Construct Lower Bounds for Van der Waerden Numbers" pdf
Ngày tải lên :
07/08/2014, 15:22
... the partition The transformation involved is called a circular translation Cyclic certificates have the favorable property that they can be repeatedly appended to create larger certificates A cyclic ... Regularities in certificates Many Van der Waerden certificates known turn out to exhibit some form of regularity To illustrate these regularities, we first introduce two methods to visualize certificates ... prove to be very valuable in the search for high Van der Waerden lower bounds Following Rabung [13], one additional number can be added to the set Cr A repetitive cyclic certificate is defined as:...
- 18
- 400
- 0
Báo cáo y học: " Serum levels of hyaluronic acid and chondroitin sulfate as a non-invasive method to evaluate healing after cartilage repair procedures" pptx
Ngày tải lên :
09/08/2014, 14:21
... methods to evaluate the quality and maturation of reparative tissue will substantially advance the field of cartilage repair These tests would potentially enable investigators and industry to develop ... aimed at repairing articular cartilage, assist surgeons to select the appropriate procedure for any given patient, and post-operatively, allow an individualized determination of when it is safe ... Nganvongpanit K, Pothacharoen P, Chaochird P, Klunklin K, Warrit K, Settakorn J, Pattamapaspong N, Luevitoonvechkij S, Arpornchayanon O, Kongtawelert P, Pruksakorn D: Prospective evaluation of...
- 2
- 358
- 0
Báo cáo khoa hoc:" A method to optimize selection on multiple identified quantitative trait loci" docx
Ngày tải lên :
09/08/2014, 18:21
... effect aA + aB aA + dB dA + aB dA + dB aA + dB aA − aB dA + dB dA − aB dA + aB dA + dB −aA + aB −aA + dB dA + dB dA − aB −aA + dB −aA − aB BV t Mean polygenic breeding value As,1,t + Ad,1,t As,1,t ... 16 A1 A1 B1 B1 A1 A1 B1 B2 A1 A2 B1 B1 A1 A2 B1 B2 A1 A1 B2 B1 A1 A1 B2 B2 A1 A2 B2 B1 A1 A2 B2 B2 A2 A1 B1 B1 A2 A1 B1 B2 A2 A2 B1 B1 A2 A2 B1 B2 A2 A1 B2 B1 A2 A1 B2 B2 A2 A2 B2 B1 A2 A2 B2 ... enable its application to a large number of situations and alternatives Dekkers and Chakraborty [3] recently applied the method to optimal selection with a single QTL for a wide range of additive...
- 26
- 205
- 0
Báo cáo y học: " SpeCond: a method to detect condition-specific gene expressio" doc
Ngày tải lên :
09/08/2014, 23:20
... adjusted p-value are presented in the bottom table Additional files The following additional data are available with the online version of this paper Additional file 1– Supplementary material The document ... the United States of America 2004, 101:6062–7 15 Ihaka R, Gentleman R: R: A Language for Data Analysis and Graphics Journal of Computational and Graphical Statistics 1996, 5:299–314 16 Team RDC: ... conditions We compare SpeCond against several alternative approaches using a gold standard dataset and demonstrate that SpeCond outperforms other methods Finally, we apply the SpeCond approach to...
- 29
- 380
- 0