... and precursor to DM), increased levels of cholesterol and triglycerides, lipodystrophy, and the onset or complication of diabetes[18,60] HIV, Metabolic Syndrome, and Heart Disease Metabolic Syndrome ... relationships between TB and DM, and the possible mechanisms through which this link may be caused, we then discuss the link between antiretroviral therapy (ART), metabolic syndrome (MS) and cardiovascular ... may increase the risk of metabolic syndrome (the clustering of abdominal obesity, hyperglycaemia, dyslipidaemia and hypertension) and thus predispose to type diabetes and cardiovascular disease[6,7,9,11,17,18]...
Ngày tải lên: 11/08/2014, 14:21
... mmol/L) + Symptoms History and Physical Exam History and Physical Exam Diabetes Self-Management Skills Lifestyle Patient Education BG Monitoring Medical Nutrition Physical Activity Glucose Insulin ... mmol/L) + Symptoms History and Physical Exam History and Physical Exam Diabetes Self-Management Skills Lifestyle Patient Education BG Monitoring Medical Nutrition Physical Activity Glucose Insulin ... mmol/L) + Symptoms History and Physical Exam History and Physical Exam Diabetes Self-Management Skills Lifestyle Patient Education BG Monitoring Medical Nutrition Physical Activity Glucose Insulin...
Ngày tải lên: 12/08/2014, 20:58
Tài liệu Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987-2006) docx
... status, co-morbidity, and lifestyle-related habits associated with LTPA and physical fitness in older people; and, 3) to analyze time trends in prevalence of LTPA and physical fitness in the period ... sleeping > hours per day and those sleeping < hours per day Statistical analysis In this study we analyzed physical activity and physical fitness separately for men and women and we excluded respondents ... and age group in leisure time physical activity and physical fitness between 1987 and 2006 WOMEN Age group SNHS 1987 SNHS 1993 SNHS 95-97 SNHS 2001 SNHS 2003 SNHS 2006 P-value* Leisure time physical...
Ngày tải lên: 14/02/2014, 06:20
The Health Benefits of Physical Activity for Girls and Women ppt
... of physical activity in the prevention of estrogen-related cancers C Literature Review Physical activity and breast cancer risk Physical activity and risk for endometrial cancer Physical activity ... understanding of the relationship between physical activity and health status, supporting increased participation in physical activity, and enhancing health and quality of life through physical activity ... of physical activity for health and well-being, as well as the current context of women’s health and participation in physical activity The general benefits of physical activity for health Physical...
Ngày tải lên: 05/03/2014, 13:20
Báo cáo khoa học: Physical properties and surface activity of surfactant-like membranes containing the cationic and hydrophobic peptide KL4 potx
... experimental and clinical meconium aspiration syndrome [13] and in patients with acute respiratory distress syndrome (ARDS) [14] The surface activity of KL4 peptide incorporated in bilayers and monolayers ... peptide and lipid bilayers, and their dependence on calcium Therefore, the objectives of this study were to analyze (a) the effect of KL4 on the physical properties of membranes, in the absence and ... 1-palmitoyl-2-oleoyl-phosphatidylglycerol and ⁄ or PA [15], which may decrease the miscibility between these lipids and DPPC A high level of miscibility between DPPC and POPG in bilayers or monolayers has been reported [15,25] and...
Ngày tải lên: 30/03/2014, 11:20
báo cáo hóa học: " Clinical assessment of the physical activity pattern of chronic fatigue syndrome patients: a validation of three methods" pptx
... the structured 'Activity Pattern Interview' (API), the International Physical Activity Questionnaire (IPAQ) and the CFS -Activity Questionnaire could accurately assess the daily activity pattern ... from which mean Daily Physical Activity scores are computed Actometers yield valid and highly reliable data in the healthy population [13] and in the CFS population [8,14] The activity pattern of ... −0.192*social) ( 'physical' = score on subscale 'physical activity' , 'rest'= score on subscale 'rest', 'aids' = score on subscale 'using aids', and 'social' = score on subscale 'social activities') And the...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Retrospective examination of injuries and physical fitness during Federal Bureau of Investigation new agent training" docx
... injuries, physical fitness, and the association of injuries and physical fitness in FBI new agent trainees Methods This project involved a retrospective examination of injuries and physical fitness ... Age, physical activity, physical fitness, body composition and incidence of orthopeadic problems Res Quart Exerc Sports 1989, 60:225-233 36 Ready AE, Boreskie SL, Law SA, Russell R: Fitness and ... push-up, sit-up and 300-meter sprint performance and improving 1.5mile run times Associations between Fitness and Injuries Because of the limitations in defining and separating overuse and traumatic...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo y học: "Comparison of prevalence of metabolic syndrome in hospital and community-based Japanese patients with schizophrenia" potx
... (mg/dl)f ≥ 100 ≥ 100 ≥ 110 a Metabolic syndrome if three of five criteria are met Metabolic syndrome if waist circumference plus two criteria are met c Metabolic syndrome if waist circumference ... with and without the metabolic syndrome Schizophr Res 2005, 80:9-18 Bobes J, Arango C, Aranda P, Carmena R, Garcia-Garcia M, Rejas J: CLAMORS Study Collaborative Group Cardiovascular and metabolic ... [http://www.idf.org/webdata/docs/ MetSyndrome_FINAL.pdf] 14 Examination Committee of the Criteria for Metabolic Syndrome in Japan: Definition and criteria of the metabolic syndrome in Japan [in Japanese]...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" ppsx
... hypertension [11,12], and central obesity [11]: these may collectively contribute to the development of the metabolic syndrome [13,14] and atherosclerosis [15,16] The metabolic syndrome, first described ... the metabolic syndrome (dyslipidaemia, hypertension, hyperglycaemia, and central obesity) as well as the metabolic syndrome itself documented Information regarding GC (oral prednisolone) dose and ... gender, height, weight, and waist circumference), a full medical history (including specific details regarding RA and cardiovascular disease), and current disease activity and physical function, using...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "Metabolic syndrome in rheumatic diseases: epidemiology, pathophysiology, and clinical implications" doc
... Clearfield M; 4S Group and the AFCAPS/TexCAPS Research Group: The metabolic syndrome and risk of major coronary events in the Scandinavian Simvastatin Survival Study (4S) and the Air Force/Texas ... morbidity and mortality associated with the metabolic syndrome Diabetes Care 2001, 24:683-689 30 Malik S, Wong ND, Franklin SS, Kamath TV, L’Italien GJ, Pio JR, Williams GR: Impact of the metabolic syndrome ... Packard CJ, Cobbe SM, Shepherd J: Metabolic syndrome with and without C-reactive protein as a predictor of coronary heart disease and diabetes in the West of Scotland Coronary Prevention Study Circulation...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" pptx
... hypertension [11,12], and central obesity [11]: these may collectively contribute to the development of the metabolic syndrome [13,14] and atherosclerosis [15,16] The metabolic syndrome, first described ... the metabolic syndrome (dyslipidaemia, hypertension, hyperglycaemia, and central obesity) as well as the metabolic syndrome itself documented Information regarding GC (oral prednisolone) dose and ... gender, height, weight, and waist circumference), a full medical history (including specific details regarding RA and cardiovascular disease), and current disease activity and physical function, using...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học: " Activity of enzymes and fitness variation" doc
... a-Gpd, Me and a-Gpd, Adh and ldh, etc.) On the other hand, there is marginally significant negative association between Adh and G-6pd, as well as G-6pd and 6-Pgd Dissimilarity in the activity ... between fitness characteristics and developmental, metabolic, and genetic properties could be evaluated This knowledge may significantly change our understanding of how individual organisms and populational ... of fitness (Dobzhansky et al., 1964), which includes activities of many genes, and has a relatively low heritability (e.g., Brncic and Budnik, 1974; De Oliviera and Cordeiro, 1981; Marinkovic and...
Ngày tải lên: 09/08/2014, 22:22
Báo cáo y học: "NPAS2 and PER2 are linked to risk factors of the metabolic syndrome" pps
... Clock gene leads to metabolic syndrome in mice [12], and in humans Clock polymorphisms have been associated with obesity and metabolic syndrome [13,14] Cellular metabolic states can serve as ... ACAAGGAGCCGGGTTCTG and the reporter sequences CTTGGGCATTTTCAT and TTGG GC GTTTTCAT for PER2 10870, and GCTCAGCAGCAGCCT GAA and CGAAACTGCGACTGGTCTGATT and the reporter sequences CTTGCTACAAGTATCTC and TTGCTACAGGTATCTC ... Obesity and metabolic syndrome in circadian Clock mutant mice Science 2005, 308:1043-5 Scott EM, Carter AM, Grant PJ: Association between polymorphisms in the Clock gene, obesity and the metabolic syndrome...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo khoa hoc:" Influence of an outpatient multidisciplinary pain management program on the health-related quality of life and the physical fitness of chronic pain patients" pps
... household) 40 items on fear and anxiety responses specific to pain Physical and psychological health Physical, psychological and social function, role behavior caused by physical and psychogenic disorder, ... Figure standing on left (left) and right leg (right) One leg One leg standing on left (left) and right leg (right) Boxplot before (pre) and after (post) month ambulatory intervention and follow-up ... Gesundheitszustand (Handanweisung) Hogrefe Verlag für Psychologie 1998, 7: Ware JE, Gandeck B, and the IQOLA Project Group: The SF-36 health survey: development and use in mental health research and the...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc
... baseline and at month-3 At baseline, patient demographics and characteristics were recorded At both visits, vital and physical parameters were collected, and fasting blood samples were drawn and analyzed ... treatment guidelines which demand the regular monitoring of relevant physical and laboratory parameters; in several countries these are meanwhile regarded clinical standard of care [21,22] Few data ... http://www.biomedcentral.com/1471-244X/11/173 Page of 11 Table Definitions and reference ranges for metabolic syndrome according to NCEP-ATP III and AHA/NHLB Risk factor Defining measure NCEP-ATP III Defining...
Ngày tải lên: 11/08/2014, 16:20
children and adolescents with type 2 diabetes andor metabolic syndrome pathophysiology and treatment
... DecisionPath for Metabolic Syndrome International Diabetes Center Master DecisionPath for Metabolic Syndrome Fat Mass International Diabetes Center Role of Obesity In Metabolic Syndrome • • TNF-α ... Decrease energy intake (calories) and increase energy output (activity) • Replace, Reduce and Restrict foods and drinks to achieve goals • Increase level of activity appropriate to child or adolescent ... in Children and Adolescents Environmental/Lifestyle Factors Change in diet- high fat and carbohydrate Increase in portions and availability of food products Decrease in physical activity Increase...
Ngày tải lên: 12/08/2014, 20:58
ROLE OF VOLTAGE-DEPENDENT K+ AND Ca2+ CHANNELS IN CORONARY ELECTROMECHANICAL COUPLING: EFFECTS OF METABOLIC SYNDROME
... Epidemic of Obesity and Metabolic Syndrome 20 Coronary Blood Flow in Metabolic Syndrome 22 Metabolic Syndrome and Coronary Ion Channels 26 Hypothesis and Investigative Aims ... receptors and ion channels that are downregulated in metabolic syndrome are depicted in green Factors, receptors and pathways that are upregulated in metabolic syndrome are depicted in blue and/ or ... by metabolic syndrome as evidenced by the significant reduction in percent repayment of incurred coronary flow debt (i.e repayment/debt ratio) * P < 0.05 vs lean-control 25 Metabolic Syndrome and...
Ngày tải lên: 24/08/2014, 11:10
IMPAIRED CARDIOVASCULAR RESPONSES TO GLUCAGON-LIKE PEPTIDE 1 IN METABOLIC SYNDROME AND TYPE 2 DIABETES MELLITUS
... Diabetes Mellitus, Metabolic Syndrome and Cardiovascular Disease Glucagon-like Peptide and Systemic Glucose Regulation Glucagon-like Peptide and the Heart Glucagon-like ... dyslipidemia and obesity are often associated with hyperglycemia or overt T2DM (4, 5) Clusters of these conditions have been termed metabolic syndrome (MetS), and patients with MetS and/ or T2DM ... demonstrating clear and readily quantifiable region of ischemia induced by focal occlusion (bottom right panel) 88 xi Chapter Diabetes Mellitus, Metabolic Syndrome and Cardiovascular Disease...
Ngày tải lên: 24/08/2014, 12:16
DIET-INDUCED DYSLIPIDEMIA DRIVES STORE-OPERATED Ca2+ ENTRY, Ca2+ DYSREGULATION, NON-ALCOHOLIC STEATOHEPATITIS, AND CORONARY ATHEROGENESIS IN METABOLIC SYNDROME
... STEATOHEPATITIS, AND CORONARY ATHEROGENESIS IN METABOLIC SYNDROME Risk of coronary artery disease (CAD), the leading cause of death, greatly increases in metabolic syndrome Metabolic syndrome (MetS; ... artery disease and stent-induced stenosis in metabolic syndrome Exercise attenuates TRPC1 expression and function in metabolic syndrome, thereby protecting against development of CAD and stent-induced ... were MetS-prone a metabolic profile was obtained for Ossabaw C and H and Yucatan C and H Ossabaw C and H groups had a greater body weight and body mass index (BMI) than Yucatan C and H at sacrifice...
Ngày tải lên: 24/08/2014, 12:40
ROLE OF ADENOSINE A1 RECEPTORS IN NATIVE CORONARY ATHEROSCLEROSIS, IN-STENT STENOSIS, AND CORONARY BLOOD FLOW REGULATION IN METABOLIC SYNDROME AND EXERCISE
... in lean, metabolic syndrome (MetS), and metabolic syndrome aerobically exercise trained (XMetS) Ossabaw swine .109 Figure 4.2 Correlation study among plasma aldosterone, A1R and PCNA ... prevents micro- and macrovascular disease in porcine model of hypercholesterolemia and coronary artery disease 1.3 Metabolic syndrome Atherosclerosis is increased 2-4-fold in metabolic syndrome (MetS) ... 85 Table 4.1 Metabolic data and aldosterone of Lean, MetS and XMetS Ossabaw pigs near the end of the 14-month study .114 Table 5.1 Metabolic data of the Lean and MetS Ossabaw pigs...
Ngày tải lên: 24/08/2014, 13:30